Description :
From Genome Similarity Track
Location :
contig_6:195027- 196628
Transcript NameFunction/comments
g2083.t1ETL33700.1 hypothetical protein L916_13891 [Phytophthora parasitica

Sequence
1601 bases(100 bases per row)
CACTTAACTCACGTTTAACATTGTGGTGAGCTCCAGCTTGCCACCTTTGGTCGATCGCGGGATCCAGAGCAAGAGAGACCCTCCTCCAGTTCCTGGGATG
CCCAAGAAACCAGCTCGCCACCGATCCAAGTACAGCGTCTTGCCTCCAAGCGCCGCCACATTCGAGACCCAAGTGACGCTCGTGCCAGCCTTGACCTTCA
CCTGGTCGATCTTGTCGCCCCCTGACATGATGTTCACACTAACGTCTTCAGTGTCAGAGCTTTCGAAAGTGATGGTAACACTGCCGTCACCGTTCTTGGT
CCAGATGCCGGCGCTGTTGTTGAAAGCCTTTCCGACAGTTGTTAGTGCCAAAGCTTCCTCAGCGGAGCCGTCATCGACTTCACCGACAAACTCGTGGGTC
TGCAAATGCTCTGAAAGAACTCCGAGACCACACCAGCAATGTTCGTGGGGTCCCAAACTGCCACGAACGTCATGGTCTTGTCCGAAATGCTGTAGGCGTA
CTCTTCGGCGGAGAGAAACGTACCGTTGTCGCTCGTCCCGGAGCTGATGAGATCATCCACGATCCCCCCGAACGTCTTGCGGAGCGTATCTCGCGTAGTG
TACGCAGTCGTCTCGTCGGATTCAGCGATCAGTTGCTCCATGCAGTTGTTCGTCGCTATCGGGATCTCGTACAGCATGAGGTTCGAGTCGTACATTTTCA
TGCGGATGTCAGCTTCAGAAATGGACGGGTTCGCGCTGCGGAGGTTTGCTATCGTGAGCCACACGCGGTCGGTAAGGCGCTTCATGTCCTCGCTGCAGGT
TGAGTTGGACTTGAGAGCAGACTGCAGCGATGTGATGTCAGTCGCGTCCAGATCGTCGAGGGTATCTCCTAACGTGATATTTTTCATGAAGCTCGTGAAC
GATTCCCAACTGGACACGATGGCGTCCTTGTAGGTGACAATCTCCTTCACGAACAGCTCGATGGTGTTGGTGACTCGGTCTGAAACCTTCATCCCCTTGG
AGACCTTGATTCCGAGACAGCTCATTACAGTAATTGGTAAATCGAACACCACGTTGTCGGTCTGGTACAACTTGGTCATCAACTGGTCGGTCGTGGTCTG
CGGGTCAGTGACCTGCACAGTTCTCACGTATTTCGCGACCTCTTTGCCGCATTGGAACGCAATTTGAACGCCCTTCGCCATGTTGGAGAACACGCCATAC
GCTCCAAATGTAGCGACAGACAGTGCGGATCGGGCCACGGCCGTCACCTTGGACAGCATTTCAAGCGTACAATCATCGTTTTGCCGGATACATTGCACTC
CGCACTCGACGGGGTACTCCAACGGACACTGAGCCCAGCAAGTTCCCAACTTGTACTCGAAGCCGATCGGACACACGTCCGCCACATGCGATTCACGGTA
ACACGCCATGTCGACTCCTGCGCCGAAGCCTGGCCCGACCCAGTTGATGTAGGTCGACTTCAAGGTGCTGATGTTGGCCGATAAATTCAAGTCCACGAGC
TCCAAGCTATCCGACGAGTCGTCTTCGTAGTCGTCGTCGCTGTCGTCTGAGTCGGCATCATCGATGGACATCACAACGGAAGGTGACGGGGACGGCGTCG
G