Description :
From Genome Similarity Track
Location :
contig_6:195022- 196623
Transcript NameFunction/comments
g2231.t1XP_008909956.1 hypothetical protein PPTG_14420 [Phytophthora parasitica INRA-310

Sequence
1601 bases(100 bases per row)
CACTTAACTCACGTTTAACATTGTGGTGAGCTCCAGCTTGCCACCTTTGGTCGATCGCGGGATCCAGAGCAGGAGAGACCCTCCTCCAGTTCCTGGGATG
CCCAAGAAACCAGCTCGCCACCGATCCAAGTACAGCGTCTTGCCTCCAAGCGCCGCCACATTCGAGACCCAAGTGACGCTCGTGCCAGCCTTGACCTTCA
CCTGGTCGATCTTGTCGCCCCCTGACATGATGTTCACACTAACGTCTTCAGTGTCAGAGCTTTCGAAAGTGATGGTAACACTGCCGTCACCGTTCTTGGT
CCAGATGCCGGCGCTGTTGTTGAAAGCCTTTCCGACAGTTGTTAGTGCCAAAGCTTCCTCAGCGGAGCCGTCATCGACTTCACCGACAAACTCGTGGGTC
TGCAAATGCTCTGAAAGAACTCCGAGACCACACCAGCAATGTTCGTGGGGTCCCAAACTGCCACGAACGTCATGGTCTTGTCCGAAATGCTGTAGGCGTA
CTCTTCGGCGGAGAGAAACGTACCGTTGTCGCTCGTCCCGGAGCTGATGAGATCATCCACGATCCCCCCGAACGTCTTGCGGAGCGTATCTCGCGTAGTG
TACGCAGTCGTCTCGTCGGATTCAGCGATCAGTTGCTCCATGCAGTTGTTCGTCACTATCGGGATCTCGTACAGCATGAGGTTCGAGTCGTACATTTTCA
TGCGGATGTCAGCTTCAGAAATGGACGGGTTCGCGCTGCGGAGGTTTGCTATCGTGAGCCACACGCGGTCGGTAAGGCGCTTCATGTCCTCGCTGCAGGT
TGAGTTGGACTTGAGAGCAGACTGCAGCGATGTGATGTCAGTCGCGTCCAGATCGTCGAGGGTATCTCCTAACGTGATATTTTTCATGAAGCTCGTGAAC
GATTCCCAACTGGACACGATGGCGTCCTTGTAGGTGACAATCTCCTTCACGAACAGCTCGATGGTGTTGGTGACTCGGTCTGAAACCTTCATCCCCTTGG
AGACCTTGATTCCGAGACAGCTCATTACAGTAATTGGTAAATCGAACACCACGTTGTCGGTCTGGTACAACTTGGTCATCAACTGGTCGGTCGTGGTCTG
CGGGTCAGTGACCTGCACAGTTCTCACGTATTTCGCGACCTCTTTGCCGCATTGGAACGCAATTTGAACGCCCTTCGCCATGTTGGAGAACACGCCATAC
GCTCCAAATGTAGCGACAGACAGTGCGGATCGGGCCACGGCCGTCACCTTGGACAGCATTTCAAGCGTACAATCATCGTTTTGCCGGATACATTGCACTC
CGCACTCGACGGGGTACTCCAACGGACACTGAGCCCAGCAAGTTCCCAACTTGTACTCGAAGCCGATCGGACACACGTCCGCCACATGCGATTCACGGTA
ACACGCCATGTCGACTCCAGCGCCGAAGCCTGGCCCGACCCAGTTGATGTAGGTCGACTTCAAGGTGCTGATGTTGGCCGATAAATTCAAGTCCACGAGC
TCCAAGCTATCCGACGAGTCGTCTTCGTAGTCGTCGTCGCTGTCGTCTGAGTCGGCATCATCGATGGACATCACAACGGAAGGTGACGGGGACGGCGTCG
G