Description :
From Genome Similarity Track
Location :
Scaffold_47:1950- 3190
Transcript NameFunction/comments
Phypl_g1738hypothetical protein

Sequence
1240 bases(100 bases per row)
AGGGTAACTAGCGTTTCAACGCCATGGTGCACCACGTCATCGAGACTGTTGTCGTCCcaggcggcaagaagaagctaACTGTGTATGCCGACAACTGCTG
CGGTCAAAACAAGAACAATTTGGTCATCAAGTTCTTGCTGGCTCAGGTTCACATGGCAGTGTTGGAGCGAGTGGACTACAAGTTCTTCGTGAAAGGGCAC
ACGAAGAACTCGTGTGATCGAGGCGTTGGTCATATGCGCAAGTTCGTCGCACGTCAAGACTGTTGGACGCTCGAGCATGTTGTGGATGCTGTGAGGGACT
CAGTGACGTCAAGTAGAACGGTCCACATCTCCCGCGATGACGGGGTTTTTAAAGCCTACAAGACGCTCGTGAAGGAGCTATACAAGAACCTAACCGGCGT
TTAGCAGTACCAGTGGTTTGCAATGGATGCGATCAAGCCTGGTGTCGTAGAATGCAGGAAGGTTCCTAGCAGCGATCCCGAAGAGCAGAACCTGCGCCGA
AAGTCGACGGTGTGCTCACTGAAAGCGACAAGGTGACCCGGATGTTTGAGCACTTCCTGGAGCCACTGGCGCCCTCATCGTTGAACGCAGAGAAGCTTCA
TACCATGCACGACTTGGTACGTCCCTACGTTCCAGACGAGTTCCAGAGTGACGCGATGTACGCAGTGCCTACCAGCCAGGAAGGAGAAGCCGCAACGGTA
GCTAAGCAGTCTCGTCGTGAGCACCGAGCTATCATGGCAGCTGCGGCTAAGGCGAACCAGAATGCGCGTGGAAGATATGGCGATGGTGAGGACGCTCCAA
GAAGCCACACAAGTCGACCGGAGGGTCATTTACCGCTCAATGGCAGCATCCGAATGCTCAACAAGGACATTCATTCAATCTGATACTTACCTCCCGGGGC
AAATCAAATTGATACCTATTGGCATATGTATGTCACTAATGTGAAGCCGGGGTCAAAAGCAAACTTTTCGAGAGGTTTTACTTCGAGTTTGAAGAATCGG
AAAGTTTCATTGGATCCACAGCGCAATTTTACGGCATAGTAGCCAATAAAACAAAATTGACTTTTCGGTCTGGGATGGGAGATATTTTTTTCGAAGGATC
ACATCTTCGTCGGATCTAACTTTTGGAAATTCTGAGAGGTCGCAATCGATAGGTAAGACGCCCTACTTTCCGCTGGTGTGCctaaatcgcgattcgtacT
TTAGTTGATAAGCATACTTAGGTAAGCCGCTGTCTCATAT