Description :
From Genome Similarity Track
Location :
Scaffold_5316:195- 1667
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_5316-snap-gene-0.0Zinc finger in N-recognin family protein

Sequence
1472 bases(100 bases per row)
TGCGATAATGTGCTGATTGTCGAGTTTCTCAAGTCGGTGGCCCTCAATCCAGCGTACGGTCGCTATCAGTGTGTTCGAGAAGGATGCAACGGGTTGATGA
CACGTTTCTTCGTTGCAAACGACAAGGCGCCGTCTTCGCTGCTTGGTGTCATGGTACGATGGGATTGTGCGCTGCGCAAGCGCGTCGCACACGTTGGTCA
CGCATTGCTACGAGAGCATATGCTCAACAAAACCTTCCGCAAGTGTATGTTGGAATCGTACGCGACGTCATACGGAGCAATGACCCAGTCGTATCTGAAA
GGCTTGGGGACTTCACCCGACTCAATCTTCGATTTCGCCGTCCAGTTTCTGACCGTGCCACAACTTGTCAAGGATTATACGAGAACCGAGGTGGAGAAAG
ATCCAAGCAAGCCGCAACTCGCGTACGAGCTTCTAGCTGCAACAGAGAAGGTATTGGCTGCAGCTGTGAAGAAGGCGGCTTCAGATGGTGAGGAGGATAC
GCTGAACGTCGACCACCCTGCATTGAGCAGCCAAAAGTACAAGCACTGCATCGACGACCTCGAGTACGTATTCAATGTCGGCGCGCTGCCGAATGAGCTC
GTGTGTGATGATCGGAATCTCGGCCTCTGGATTTCGTGCCTTAAGATGCTCCAGAATGGCGATCTGCAAGCTCGGCGAGGTATCCGTGAGAGCCATGTCG
AGTACGAATCCGACTCGTGGCTCTCCATGTTCAATCTTGGCATTCGCGTCCACTCGATCTTCCCTGTCTCATGGAATGGGATGCCACCCGAAGCACTCGT
AAACAAACAGCAAACTGTGAAACACATCTCGCAACAAATTATCGACACGGTGATCAGCTCGTCCATCGCAGCTAACCAGAAGACCACAACAAAAACGATA
GTACCGATCAAGGCGCTACGATGCGGCACGAATGGGACGAGTGAGTGCGAGGTATACGATTTTAACGTGTCAGCATCCAAGACATCCCTCCATGTGCCGC
TGCATCGGTTCCTCGCCTCGTCCATCCGCCATGTGTCGATTCACGTCTCCTGGTTGCAGGAGGTACTGAACGCCGAGGGTTTACTTGCGGCATTTGCACT
CGACAAGCTGCCATCTGAGAAGAAGATCGAGCTTGTTGAGTTGCCGCTTCGAAGCTTGGTTATGGCGTCGCAGATCCAGTCCAACTTGTGGCGACGAAAT
GGAGAGGAGAACATGATGGCACAGCTGTACAACTACTCGGCGCTGCCGTACTGTGTGCACTACCGGGACGCTGATGTGTTCTTGATGCAAGTTGCGATCC
TGCTTCTCGGCCCGGACACTCTACTCTCGCTCATGGTCGACCGATTTCAATTGGGGGACTTTTTCAAGTGTCAAAGTATGGGTTACGCGCCTCAGGAAGA
AGGCGTGGATGCGCAGCAAGAACTGCAAATGGTGGAGGAATTTTTGCGGCTCATCATCGTGCTCGGCACAAG