Description :
From Genome Similarity Track
Location :
Scaffold_212:19492- 24799
Sequence
5307 bases(100 bases per row)
CTAAGTCTTCCTCTGACTTTAGGAGCTGTGCAGCTCCGCTACACTTGGTAGCACTTGTAGTCAATCTACGCCTGAGTCTTTAAAGACTGATCATCTGTGA
GGATGGAAAACCCCACTCCCCTCTTTGAGGCCCAAAAGATTGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGAGTATGTGGAATTCCTTGTATCGCA
AGGCCTGGAGGTGCTGACTGCACGTGTTGAAGGTCTTCTTGCAGTACGAAGCGTTCCTTCTAGGGCAGGTCTAATACCAAATGGCTTCGATTATGCCTAC
ACGCTATGTGTCATTCCAGACAAAGAGGCTAGGCCTCATCCGCTTGAAGTGGAAGTTAAAAACTACTCAGGAAAAGAGGGTGAAAACCTCATCCTCTGGA
TCTGTGAGATTGAGATGGCCATGAGATTAGGCCTGATCAAGCTTGACCATCAACAGGTCTCGAGGCTATCTCAAAGCTCGATGGAAGAGCTAGAGAATGG
GCCTTGACGTGTAGCATGTCGGTCGACTTAGCGTTTCCCACATAGGAGTCGCTTAAGTCACAATTATAACAGGTGTTTCACCACCTAACCAGGCTTACCG
CGTGCGTTCACGCTTTTTATCATCCCGTCAGGGTAAGAATGAGTTAACGGACTATGTCCAAGAGCTGAGAACTCTCATAGCTGCTATGCAGTCTGACCCT
CTGCCTGAGGCAGTCCATGTGACTATATTCATGAAGGGTCTCCGTACTGGCATTGCCAGAACCGAAGTCTTTCGGGTTCACCCCTCTACATTCGAAGAGG
TTGTGAGAATTTCTCTTAATACTGAGCATAACTTCAAGTCGGCCAGAATTGGATGGAATGGGTACAACCCTTTCTCTGCAAGAGCAAACTACACGAGTAC
TCCGGTCGGTAATAGGCCAGAACCGATGCCTATTACCGACCGGAGTACTCGTGTAGTTTGCACTTTCGTCTTCAGCAATGCTGAAGACGAAAGTGACGTG
GAACTTCAAGATGCTGAGCAGCAACGTGTTGTGCGACGGTGTTATACGCGTGGAAGCACTAAGCACTTGTGGCCTGGTTGACCTTTGCGTGGAGAGAGCC
AGGATACGAGTCAATACTCTACTCCGAGCCAGAAGTCTGGCATGGCACGAGAAAATGCCGATACCCAGTAGGCGCGGGGAGCCCTACTGGGGAAGAACTA
GGTTCTGTAACACCTTCAGGAGATAAAGTTGAACAGGGCTTAGCCCCAAAGAGTTCCATACCTATTGGTATGGAGCGTGGATACAAGGCTGGCTTGTTGG
TCGCTGAGGCGAAAGTAAAGGCTTTGAAAAGCCTTGGTCAATTTTAATCGATTCTAGAGCTTCTTGCAATTATGCTCGACGTCGTTCGCTTGAGGGAAGT
CATCTGTATGCTGAAGCGCTTACAGAGCATGAGGGTTATTCCATCACGGTTCGTTTTGCGACTGGAAGTCGTGTCACTGTACCTAAAGTTTCGTTGAACT
TAGGTATAAAGTTTTTGGACTTTGATAGCATTGAACGCTGTCTTGTCCTTGATTTGGACTCGAGATATGATCTCATCCTAGGTATGACTTGGCTTGAACG
CCATGAGCCATAGATTAACTGGAGGTCGAAGACCTTAGGCGCTACGCGCAATGTTCCTAGAGAAGCTTTGGAGAGTCATGAACCTACCTTTGCTAGGCAA
CAAAAGCACTATTGGCGCGAGCCTTTGACAGAAGATGTCAATGTGCTGGACATTGGAATGTCTGAGTGAACTAACTCCAATGTTGAAAACATGAATTCCG
AGCGTAGCTCGTTGAGTATTAGTGTTACGGCACGTATTCCGTTGAGTGTTACTCGTTGTGATAACGAGTCACTGCATGCTGAAAGCATGGTTAGCCTTGG
GCCGAGTTATCAAGGATGTGATTCCTTTGATGTGTGTGTGGTGGCACGTGAAAATGCACCGAGTGCGGTCGGCCGTGAAGGCACCACACTTAATGTCGGT
AATGACATTGTTGGCGAAACGCCATTAAGTTCAAGGCTAGGCTCGTATAATGTAAGTGGAGTGGCACTTCTAAATCCGCTGTGTGAAGTTTTCGATTTAC
GCAACACTTCACCGGATGTCGATCAAGACATCAGCTCTCGTACAGAGCGTACTACTACTAGTAGTAACTACGAGACACTATTGTCCCGACCCTAGAGGGG
GTGTAAGGTCTCATCGAAGAGACGACCTGGACATTAGGTGGCAACGGTTAGGCTCCAGGCGTCCGAGTAGTCACATAGTGACAATAGTGATACACTATAT
ACACTTGTCAACGGAGTGACTGGCCAGGTTGAGGGCAATGTTAGCCTGGTAACCCTTCCATCTTTGGATGATCTTTGTGAGCTAGACAAAATTTCTAGTG
GCGAGTTTAGCCAGGCCTTGAATGCGAGATTTATCCGAATTAGTGGTCATTAGACCCGATGTCGAGTTGAACTCGTCCTCATTAATGGATAAGTCGGTCC
AAGAGGACACCAAGGCGGCACTCAGTGCCCGGAGTGCATCTTCGATACTTAAAGATCGTTTGGATCCATTCTATCCTTTGGTCAAGGAATTTCAAGATGT
GGTGTGTCACAACTCACCATCTGTCTTACCTCCTGATAGAGGTGTACGTCATGAAATTGACCTAGTTCCAGGAACTAAATACTGAGTAACACGGCAGTGG
CCATTACCTAAGGAACAGTGTGACGTCATTGACGATTTCTTTCATGATAAGAAGGCGGCGGGAATATTGCGGGAGAGTAAGTCTCCTCATTCCACACCTA
CATTTCGTGTCAAAAAGTCTAATGGCAAGTGGCGCATTGTGCACGCTTATAATAAGCTAAATGCTGCCACTATCCCGGCTCAGACACCAATCCCCAGAAA
GGATGTACTTCAGAACAATATGGTGGGATATACATTGTACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGCTGCTCATACGAGCAAGCGATATTCCT
CTAACAGCGGTTAGTACCACGAGCGGTATGCTCTGGGAGTGGCTCGTTATGCCACAAGGGCTGTCAAATGCCCCGGCTACTTTTAACCGTCTGGTGACGC
AACTATTCAGACCTCATCGAGGCTATGCACAAACGTACTTTGACGACATCTTTGTCCATTGTCGTGCAACGAACGGTCGATCTGATGTGGATAATCACAT
TGATCGTTTACGAGCGGTGCTCGAGTGCATGCGTACGAATAAATTGTATGCAAATGCATCTAAGTGCATCTTTGGTGCAGAAGAGATTCCCTTTCTAGGG
TGATTCATTGGGAAGCGAGGCCTTCGAGTGGACCCCGCTAAGATAAGGGCCATAGTCGATTGGCCGGTTCCAAAGAACCAAAAAGGTCTACGTAAGTGGC
TTGGCCTTGCCAATTACTTGCATAAGTATAGTGAGAATTACGCAGATATGGCTCGGCCATTATCCAATCTCCTTAAGAAGGATGTGGATTAATGTTGGGG
TAATACCGAACATGATGCTTTTCAAGCAGTTAAGGAAAGTCTCCTTCATAAGCCAATACTGGCTTTGCCCGATCCTGATCGGCCTTTCAGTGTCGTCTTT
GACGCATCTGACTTTGCCATAGGCAGTGCTTTGTTACAAACAGATGTCGATGGACGCGAACGCGTCATTTGTATTCAAATCTCGACAGCTCAAAGCTGCT
GAAAAGAACTATCCAGTTGATGACAAAGAGCTACTTGCTATGAAGTACGCTCTAGTCAAATTCAGAGTACATCTGCTTAAGTCCAAGCCATTTGTGATCT
ATACAGATCATGCATCATTGTGCACTGCGACACAGTCGCCGCATCGCTCTCAGAGAATGGCTCGTTGGCTTTCATTCTTTGCCGAATATAATTTTGAAGT
GAAGTATAAGCCAGGAAAGCAAAATGCTTTGGCTGATACGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTGTTATCTTCAGTCACT
GACTTAATCCGTGCGGCTTATGCCAAGGATGAACAATGTGTAGCTTTGCTACGTGCTCTTGGGAGCAAGGAGTTTAAAACCTTGGACATAGAATTGTCGG
CACGTTTACGTGCGAGGCTACATCAATATTCTATCGATAATGGCCTGTTGCGCTATCGCACAGATATTGAGGATAAATCTCGTATCGCTGTCCCTCATGA
TGAGGAATTGAAGTATCGAATACTCTATGAGGCACATGATACTGTTTTAAGTAGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCAAGGCTTAT
CGGTGGTCCAAACTTTACAAGTGGGTGATCACCTATGTGCATACGTGTGAAACGTGTCAACGGGTGAAACCCTCAGCACATGCGGCGGTGTCGCTGGCTA
GTCTGCCTGTACCCACTGGGTGTTGAGAGTCTGGACTTCGTGTTTGGCCTACCGAAAGATTCGGATGGCAACACTGGCATTGTGGTCTTTGTTGACCGAT
TGAGCAAGATGGCTCATCTAGCGGCACTGCCGGACTCTATTGATGCCGAAAGTACAGCGAAGCTGTTTATCGACCGTATGTTTCGACAACATGGTTTGCC
AGTAGAAATTGTCTCTGATAGAGATTCCCGCTTCACTGGCAAGTTTTGGAAGTCCATCTTCAAGGTGCTCGGCACCCGTTTCGACATGTCCACAGCGGAT
TATCCGCCGACCAATGGTCAAACTGAGCATGTTAATCGCGTCATTAATGACATTTTGCGCAGTGTTTGCGCTGATAAGCCTAAGCGTTGAAGCTCCATGC
TCCCTGTTGTTGAGTTTGCGTTGAAAAACGCTGTTCATGCCTCTACAGGCTATACTCCGTTCTACGCAAACGGTCTTACCCACCCTCGCGTTCCGTTAAC
GCTACCACTATGTGGTTCAGGGCTTGGTGGGGGCGAGGTTGCCGATCGGGTTGCTGATACTGTTCAAAAAAAAACAGGTAGGCGTGTTTCTCGCAACGCG
ATTGAATGTATTAGGACATGTGCGTGACGTAATGGCTGAAAGCCAAGACCAACAAAAAAAACATGCAGACGCTAAAAACGGAGGTTGTATTGAACGTTAT
CAGGTCGGAGACCAAGTATTACTTAATGCTAAAAACCTATCTACAAGTGTAGTGTCCGCTGTCATAAAGACGAAGTTGCATCCACGCTTCATTGAACCAT
TTACGGTCACTCCCAAGAAGGGACTTGTGTATACGCTAAACCTTCCGCGCAAATTGCGCACACACCCAGTGTTCTACGTAGGCTTACTTAAGCCATACCG
GGACCCT