Description :
From Genome Similarity Track
Location :
Scaffold_574:19490- 20763
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_574-snap-gene-0.7Conserved hypothetical protein

Sequence
1273 bases(100 bases per row)
GGGACGTTTGCTCCGAAAGCACACGGCGACAAACTGAACCACAACGCCACTGCGATCGACTAGCAGTGGCTGATCGACTTGTCCACGGCGTTCGCAGCTC
AGGTTGGCGAGGTTGTTCCTGTTCGCGTGCGCCAAAAGAAGACCGACGGAAGCAATGTGATTCGGTACTTCTCTCCTGCCGACTACACGCTTCTGCCTGC
ACACTTCACTTATGACAAGTTGCACACGGAGATGCAGAACTTTCTGTTGGAGAAGAATTTGGCTGTGCGCGAACCAGCTCTGTCGACGATGCGGAAGCTG
ATAAAGACTCAGTGCCCGACGATACGAATCCATTCAGCGAGAAGCAATGTTTGCGATATTTGCGCTATCTACCACGCGCAGATGAGCGGCGGCACAGTTA
CGACTGATCTGACCGAGGCCTTTGGTAAGCACACAATGGCAGCTCGGAGAATGCGGTGAGTAACCCAAGGGATGTAATCATCATACTGTTTGATGACTGG
ATAATAGGCTCACTTCGATTTGATGTGAACATTTGTTCGTGATTTTTTCCGCAGCCTGGAATACGAGAACGACATCAAGACCGCCGACTCGAGCCACGCC
GCGATCATCATGGATTTCAGTCAGAACCTGACGCTTCCAAGCGTCTCAAGCACACTTTCCCAGTGGTATTTCCTGTCATTGTGGTCGGTGGGCATATTTG
TCATCCATCTGGTGAACAGTGACGTCAAGTACAGCTACCTTTACGAGGAGCGAATGTCGGGCAAGGGCTCAAACGAAGTCATCTCGCTGCTGGACCACTT
TGTGAAGACGGTGTTGGCACGAGAAGGATTCACGAAACCCACGATCTATACTGACGACTGCACCGGCCAGAACAAGAACAACTTCGTGGCCAAATCTCTC
CTCGCTCTCACGCACGTTGGTGACCTGGAAGAGGTAAGCCTGAAATTCTTCGTTAAAGGGCACACCAAGAATGCAGTCGATTGGGGGTTTGGCCACGTAC
GAAACAAGGTCGCTCGAGAAGACATCTGGAAGATGGAGAAACTCGTCGAGGTCACGAACGCAGCGTCGACCTCCTCGGCAACTGTCCATGTCACGCCCAA
CATAGAGGTCTTCAAGAACTACAAACAAGTGCTCGTTGACGCCTACACCGACATTCCGGGGATTCGCCAGTACCAGATCTTCTTGATGAAGGGCATAAAC
TCCGGAGTCGTGTTCGGTTGGGAAGGACCTGACAACTCGCCGACTAAGTTAAATTCGCGGCGAAGGTGCGACG