Description :
From Genome Similarity Track
Location :
Scaffold_836:1949- 5797
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_836-snap-gene-0.4PfkB domain protein
Pytve_DAOMBR484maker-pve_contig_836-snap-gene-0.7Lipid particle protein

Sequence
3848 bases(100 bases per row)
TGCGGGTGGCGATCGAGCTAGACGCGCGCGCTGTCGTCGAGGAAGTGCAGGTTCGCGGGTAGATGTTTGATCCAATTTGTGTAAATGTACCGGCGCTGAT
CGATCGTGGAGCGTAGAGGAGGCAACGGCACGAATGCGCTGGTGCGTACACGCTGCAACACTGCCGCTGTGATTCATACTAATAATGGCGGCACTTGCAT
TGCTAACGCCGTGGTAGGTTGTGTGTTCCCAACTGGGCAAGCGATGTCGGTGGATCGGCGTGTCAACAGACCCAGCCAAGGACTCCGACGCTGCCATCGC
TCTCAACGACCTGGCTTCGTTCGGGGTCGACTATTCTCTTGTGGACACGCAGCTATCCGGGAGCTTCCCCGTGTCGGTGAGTTAGTGTCTGGATTTGAAC
TATGAGATGGTACTGACGCAGATGAAAATGTGGCAGTTTATCCTCACTAGCCGACGGACCGGGTCGAGGACGATTGTGCACCACCGGAACATGCCTGAAC
TGAGCCTTGAGACGTTCAATCGAGCGTTGACTCGGTACGCGCAGACTCACCCGGCCGATGCCAGCCCAGTCTGGTTTCATTTCGAAGGACGCAACATGGA
GGTCGTGCTGCAGATGTTGCTGCTCGTGCGCTCCACATTTCGAAACGCGCTCATATCGGTCGAAATCGAGGCGCTTCGTTACGATTGGAAGGCCGCTAAA
AGGTGACTTTTTGCGTAGGCTATTGACGAAGCTTGTCGAGGCGATTTGTTATTGACAGCTAACTTTTGGTTGTTTGCTTTGTCCAACAGGTTAATGGCTG
CTGCCGACTACGTCTTCGCCTCAAAGGACTATCTCCGCGAGAAGCTGGAGCTGCAGACTGCCGAGGCGTTTTTCCAAGGCATCTTAGCTCAGCAGTGGGG
AGCGGACTGGACCAAATCGGTGCGGGCGTTCATCTGTCCGTGGGGGACGGACGGCGTCTACTACCTCGACATGTCCTCGCGTTCTATGCATCACATTGCG
GCCGAACGCCTCGATACCATTGTGGAATCCGTCGGAGCTGGCGATACATTCATCGGCGCGGCCATTGCGGGATTGTCGAGTCCAGGCTGCTCGTTAGATC
GTGCGCTTCGCTTGGCGTGTCTGGCCGCCACAACCAAGTGCACGCAGCAGGGCTTCAAATTGCCGGACAATCTGGTGGCCAAGTGGCGCCGTGAGCTCCA
GTGTGACGGCAAGTCGACCTCGTTCAAGCAGAGCACAAGCACGAACAAAATGGCCCACCAGGCAGCGTAGTGATCGAGAGTCGTTTATCTTCAAGTAACT
GTTTATTTGGCATTGCATTAAAGATGCAAGCATCAACACGCAGGTAATCATACACCTATACGCCCTGGTGGCTGTGGTTGCTCACGCGTGTACGGTTGGG
AACAGCTCGCAGCTTTCAGCATCACTCGACGGATTGGAAGCCGACGGGAATAGCTCGTAGCTTTCGGTGTCGCTCGACACGTTGCCACTGGAAGTCGGGG
ACATGGTACTGCTCGCAGTCTCGTGTGACGTCGCTGTCGAGTCTGACCCTTTCCCCACCGGTTTCTCTTGTGCCGCTAGCTCCTCCCCACCAGGAGCATC
AGGTACAACCACGGGGATCATACCGTGGTCGAGGCCAATCATATCGCACAAAAGATCGATGAACTCGTCGGCGCGACACCCCGGAGGCTGCATCTTGTTG
ATTGGCCAGTCGTGGAGGCGTAGCTTGCCCTTCACGCCGCTCGGCTCGACCGTGACGTCGATTCGACGCCAGGGTAACGCCTGCTGCTGCTGACACAGCA
TCTTGTACGGGAACTCAACTTCCTGCTTGTTGTCGCAGTCGTAGCCTTCGATGCTCGGGTATCGAGGCGTCGAGGCGGCGTCGAGGCCCATCGCATGCTC
CTCGACCTCCACAGAGTGATCCACGTGCTCGTCCAGCCTCTGCAGGAACGCCGAGCGGGGTGTGCTTTGAACATGATCGTCGATGAACCCTGAGTGGCGA
ATGTGCCATCGCCAGTCCGCGAACCGCTCAGTCAGGAAAGTGCTCTTGTACGGACTGTAGCTGCGCATCGACGCCGACGGGAACGGCACGACGACGTCCC
CATCCGTCATGGCTACCAGCGTGCCGTGTTGGAACTTCTTGAGCGCGCGGATGAACTCCGAGTCCGGGTCGCTCATCACCTCGAGCAGCGGGCGGCAGTC
AGCGCGGCTGCCTTCCGACAGCTCTTCGTCCGAGCTGCTTGCCGCGCTCGCGCTCTCGGATTGGACTAGAGCGGCAACATTCAGTCAAACTAAAGTTAGC
ATCCAGGGAGTGGTTGTGGTGACAACACGCCAGCTCGGGTTCTCACCGTCGATGAGCAGGTCGATGCCCGTCTGGCCGTACAGCTTCTTGGTCGCGAGCA
CCTTGTGGACGCCAATACGCAGGATGTTCTGTGCATCATCCACCCACCCACATCGTCACTACCACGGTATAACCACCATAGCATCATTATCCGCACCTTG
AAAGTGGATGGTCCGCGAGCGCGGCGAGAGCCGAGGTGCGGCGTGCAAATGGTCACGAAGCTCACGTAGTCGATGTTGAGCATCGCAAGCCTCTCCATGA
TCTGCGGGATCGCGAACCGCGAGTACAGCCCGCCGAGCGAGTGGCCGACGATAGACAACTTGTAGCCCGTTGCGGTCGAGCGCAGCTCCAAGGCGAGCAC
GGCTTCGACCACCTCCGCGGCGAGCTTCGAGCCGCCGACCTCGACCCCGAGCGACGTGTCGGCCGCGTTAGACTTGGACTGCACAACGAGCAGCTGGCCA
TCGCCGAACTTGGCCGTGAGCGCAGCTGCCATGGCATCAAAGTCCGCCGGCGAGCCATTGTTGCCGTGCACGAGCACGACGATGTGCGGCGGCAGGAATG
GTCCGTCCGCCATCAGTCGCCCGAATGTATCGCTGCTGCTTGGAAGGTCCGTCGGCACCGCGCGGTCTCACGGCAAGTGACGTCTCACGGCGGCAAAGTG
GCGGTGCCGGCCGGGGCACTCGCGCTCGCGATCGAGTAATGGGGCGACTGTGACACGGCCGCGGATTTCTTCGACTCAGCCATTTCAGCGCCGCCGTTTC
TCCCACATCCGGTTTGCGAGCAGTCGGTGTGTTGTCAACATGCCATGTGTAACACCGGTTGGCGCGTTAGAAACTGTAAATTGCGGTTATATTGATCGGG
TCGGATATGTTGCAAAATTATAGCGCTAAACCAGTACGCTCGCTGTCGACGTCGAGCGACTGTGCCAGGTCACCCAGTCTCTTCGACTAAATCAGTAACG
GGTCGCATCGAGCATGGCGCAATTACGCCACTGGGTGTCAGCTGGAGTATCCATCCATCGCGGTCGCAGCAGGCAATCAACACAGACGAGAGCCCCCAAA
GTGACACTTGAGTCTCCTCCCGCGCCTCAAATCCTGAGGCGCNNNNNNNNNNNNNNNNNNNNNNNATGAGAGCGATGCGAGAAGTGACTCAGACATTTTG
GCCGTCGAGTACTGGGTTATCGTTAACGGCCCATCCCCAAGCGGATTTTTTCATGGGTTCAGAGATGGGCCAGCGTTTGTAGAAAGAGAGTCGTGTCCGA
TCGAAACGGACGCTTTTGATCAACATTTCGCTCAATTGACACTGCCAATACGCCATTTTGTGCCGGCGACGCTGGCGACACACCTGGCTCTGCAACACAG
CGACTCATATCCCATTTCGATTGGCCAAAACTCTCTCCATATGGACCTCCCCATTCGCTGGCTGGACGCCACAAACCCATCCCAGACGTGCAAAATCTCA
GTCACGAGTTTCTATCGCTATATCAGTACTCGAGAACCCGAAATCGCG