Description :
From Genome Similarity Track
Location :
Scaffold_890:1949- 3315
Sequence
1366 bases(100 bases per row)
GCTGCTCCCTTTACCCGGAGCTCGTCTGCGGATGGTTAGCAGAGGACCATTCGCAGATGTACGGCCAGACGGAGCGCGTCAATCGAGTGCTTGAGGACAC
TCTGCGCAGTGTGTGCGCGCGAGCCCCACGTACGTGGTCGACACAGCTTCCAGCTGTTGAGTTTGCGCTCAACAACGCGGTACACGCGTCCACGGGGTTC
ACACCGCTCTACTTGAATGGCTTCCGTCACCCCACAGTGCCTCTGTAACGGGGTTACATGGTGTGGAGCACACAGGGGTAGGAAGTACCCGGAGAGCTAA
CAAGCTCTCAGTACATAAGTTGGAGAGTTAACAAGGTCCCTCAGTACGTTGGCGGAAAGCCACACGTTATGCATTTGATTAGGTTTAACTATGCTAGATA
GTTAAACAGATACATTTACCCCTAGGCGGCTTTGAATCGCGAGCCTTGAGTCACCGACGATGACTAAATTCTCGGCACCGTGTGCAATAGCAGCTTTGAC
ACCGTTTATCATTCCTGTGTACTCTGCCTCATTCACCATGGTGGCCGAGAGGTAAGCGTTTGCAGCAGTCACTACCTTCCACTCAGGAAGGCTCCACAGC
ACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN