Description :
From Genome Similarity Track
Location :
Scaffold_279:19482- 21015
Transcript NameFunction/comments
g15901.t1hypothetical protein
g15902.t1hypothetical protein

Sequence
1533 bases(100 bases per row)
CCTCCATGCTTGTGCTGTGGGGAGTGCGAGCAATCCCCTCGAATGCGTTTTATCCGTTTGGACAGGCTATACCCGTTATACCCGATAGTCTCCATGTATC
GATTTCAAGAGTGGAGATCGACTAAAGCGAGCCGCCTCTACAGAGTCCGTATAGGCTATCCGGATATTGCTGCCGTATGCTTGCAGCGTTGACTCACGAG
GGACTCGGCCGCCATCCGCTCCGCTGGCGCCTTCCGGTGCAATTTAGCGCAGGTACTGTAGATCAGTGACCTTCGCACGTTGGGGGTGGTTTGGTGGAGC
CTCGCAGCTGATTGCCATCTTGCTTCAAGCTCGTGCTCTTGAGGATAACGCCACGTCCAGATGCTACTATCTCCAGGCTCTCGATGCACGAACGTCGACT
AACCTTATCATTGCGATGCGCTTGTGGTGGAGAGAGGCGGAAGAGTGCGTTGCAATCGTCCGCCGCGCGCTACTTGTCCGGTTGCGAGCCTCGTGCTGCT
TGTGGTGGTGCGGCGGCGCGACGACTTCGTTTAGGTGACCCGCTGCTAGCAGCCTGCTAGCTCTCTGCTTTTCGATGCGTCGTTTCGGCGTCGTTTCGTG
TTGTCCTCGTATTACGTTGGATAGCCTCGGATAAGATAGTTTGAGTGCAGAAATGTTTTAGGCTGGAAGCGTTCCCCTCATACATCATCTTTAAGTCCGA
AATTAGATTCCTCACACCACACCATCGATACATAACGAGTTTCCACCTCACGCGCGTCGTCATCGGTCCGCCCTTTTTGGCCTTTTTCAAAACGGTCAAA
ACCAAGACGTCCTTTCCTGTTTGAGTACAGTAGCGTACAAAGTGCCATTCTTGGTCTATCCCGCCGAGCAACAGAGCAGCATGGCATCAGCCGCGGAGAT
CCGCGCCGAGAACGAGCGCCTGTCGCGCGAGATCCACGCGCTGCTGAGCGCCAACACGACGCTGCAGAAGCAGGCGATGGAGCTCGACTCGGAGCGCGAC
GCGATTGAGGCCTCTGGCAGCGAGAAGGTGCAAACGCTGGCGCACGAGCTCGAATCCGTCGATGAGGAGCTCTCGTCGCTGCGCTCGCAGTGCAGGTCCA
TGACGGAGATCCTCAAGAACGCAGACGCCCAGAACGAGGTGGACGAGGAGCCGGCACCGTTGCCAGGGAGCCGTAAGCTCTCCACGGCCATCAACCAGAC
GCTGCAGCGTGCCAGGGGCATGTCGATGCCGCGCCAGCGGCGCTCGTCCACAGTGGATATGATGGCCCACGGGCTCACCAAGGCGGCGAGCTACATGATC
CCACCCTCAGGAAAGCACAGCCCCGACGGGCCTCGTCCGCCCAGGATGAACAAGGACAGCCCGCCGATCCTGTCGTACGCCAAGGGCACCACGGACTCGA
AAAAGAGTCTGTTGTTCTCCACTCACTCGCACTACGGCAACTTCCGACGGCACAGCGGACCCTATCGCAAAACCCGCGATACCGTCATGCGCATATGAGT
TGCCTGTCCATCGCGTCGAGCCCACCCCGGCAA