Description :
From Genome Similarity Track
Location :
Scaffold_1293:1948- 6835
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1293-snap-gene-0.5DNA replication licensing factor MCM5
Pytul_var.sporangiiferummaker-pug3_contig_1293-snap-gene-0.3Phosphoglycerate mutase
Pytul_var.sporangiiferummaker-pug3_contig_1293-snap-gene-0.4WD-repeat protein

Sequence
4887 bases(100 bases per row)
GCGGTCGGACTCGCGCATCTTGTCAAACTCGTCGATGCACACGACACCGCCGTCGGCAAGCACCATCGCGCCGCCTTCAAGGTAGAACTCGCCCTTGGAG
TCCTTGATCACGGACGCCGTGAGACCCGCCGCACTGCTGCCTTTGCCCGATGTGTACACGCCGACAGGTGCCACTTTCTCGACAAACTTGAGGAATTGGC
TCTTGGCCGTTGACGGATCGCCAAGCAGGAGCACGTTGATGTCTCCACGCAGCTATTTGGTACACATACATCACCGCATATACACACACGACGAAAGGTG
AGATCGCGTAGCCACATGAAAGGTCATTGCCTCAAAACGTACAATCATTCCATCGGGCAGTCGCTTCCGTGAGCCGCCGACGAGCAGACACGCGATTGCT
TTCTTGATGTTGGTCGTGTAGTCGCCGTAGATCGACGGCGCGATGCTCGACGAGAGCTTGTCGTATAGGTCGGGGTCTCGTGCCATTTCGTGGAACTTCT
CTTCTTCGGCCGGCGAGAACGTCGCCTTTGCCCGTCCTGCGCCTTCTTCGTCAATCTGTTGTACACATATTGGAGCAAAGGCTTGTTACTATACGGCATG
CAATCCCACATCCACATACAAACCTGTAGTTAGCGTACCTCGATGCCAACAACACGCAGATACAGTGTTCGAATGGCGACGGCGCCGATCTGCTTGGCGC
CAGCATTGACCACGGACGTGATGCCCACGACCGACACTCTTGTGCCTGGCGATGCTCTGTCCACGAGGTGGCGATCCGCGATGAGCGCGAGATTCCGCGG
CATCTCACCCGTCGGGACGACCTCGGGGTTCTCTTGCAGCTTCAACGTTTGCTGGTCCACGTAGTCACAGCGATCTGGGAGCACGATGTACGAATCCTTT
GGACACAACTCGCTGCTCGGCTCTTCTTCGCGGTTGCGGTCGCAGATGCGCGGGATGTTGATGCCGCCCATGCCCGATACCGCGACGCGCTTCGAGTTGC
CGCAGTTCTTGCAGCGCAGTGTCGCCGAGACGCACTTAGTGCGCACGCGCGTGGCGCTGATCACAATGCCCGGTACCTTGACGAGTCGGTTGATCTCCTG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCACCGCCTGGATGTCCGGCAGGTTCTTGACGTTCACCGA
CTCGTTTCCAATCGCGCCGTCNNNNNNNNNNGTCTGCTCGCTCCGGTTGAGCACGAGCAGGTACGCGAGCATCTCCTTGGCGGCATTCTCCAGCAGCGGT
AGGTACTCCTTGGGGTTCTTGAGGATCAGGTCCTGCAGGAACTGGTCGTAGGTCGCCAAGTGGCTCAGGTTCATCGTGAAAAAGTAGTTGTTGCGGCGGT
AGTTGGCGATGAGCTGNNNNNNNNNNCGCGGTAGAAGAAGATCGGGCCGACGCGGAAGTTGCGCAGGAACTCGTGCAGCCGCTTCTGGATCGCGATCGGC
GATGTGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACGACACGCGTCCGACATCCC
AGTCCATGGCGTTGCTTGTGCGCTACGTGTCTGTGTGTATGTGTATGTGCTGCGGGGAGGTGTCGTCGACGAAAGGCAACGTGACGCAAGTAGGCAACTT
GTGGAGTGCACTAATGCACCGCGCGCTTTTTGAGGGGCTCGAAATGGCGCGCCAAAAAAAGCAAAACGTTTTCGACAGGTTGTATTTTTTTGACGTAGAA
GAAAGTTTTCGACAAGCACGCTGTTCGTAACCGATCTGGAACCATGTTGTAAAAACGCAATGTGCATCCTAACAAAGACATGCTGCTGGTCACCACTGTG
GTTTTTTACTGGCAGAGATGTCGCATGCGTGGTTTTTGGCAATACATAGGTGTTTGGTGCATAAACCATGCGGCATCAGTTCACAGAAGCATGCTCCTCC
CTGCCAAAAATGACACATCAGATTCGAGAGGGTCGAAACCCTCCAGCAGTGTCGCGTCATGGGCCTCATTTCGAGTTTCTTTGTGCAACCCTCAAGTCGC
CCGCCCCCAAGCAGAAGAAAAACAAAGACCACAATGGCTGGTACGTTGTGCGCGTCTACACTGTGTGTGGCCACGAGCGCTCCCCCCTCCCTCCTTTATG
GCATGGGCCTGCGCCTCTTGTTGTGTATATGGAGGGAGACTGCTGCTGTATGCGCGCCTGCTTGTAGATGCCGCATGGCGTGTGTTTTGTGAACTGAGTT
GAACTGACCGCCGACTCGTCTTTTGTTTTTTTGTTTTTTTGTTTCTGTGTGTGATGCTCAACTTGTCGATGGATATGGAATAGCCAAGTACCAAATCGTG
CTAATCCGTCACGGCGAAAGTCAGTGGAACGTCGACAACCGCTTCACGGGCTGGCACGATGTGCCTCTTTCGGCGACTGGTACGTTAATTGCTGCTCAGT
TTTGCTGCGCTGTAATGTGGTCTTGTTTTTCTAACCGTGGCACACACTTGTGTGGATTTTTTGGCGTGTTGTAATAGGCGAAAAGGAATCGCACGACGCC
GGTAAGGTACTCAAGGAAGCTGGTTTCAAGTTCGACTTGGCGTACACGTCGGTGCTGAAGCGCGCGATCAAGACGTTGTGGAACATCTTGGAAGAGACCG
ACCTCATGTGGATCCCTGTGACCCGCTCGTGGCGTTTGAACGAACNNNNNNNNNNNNNNNNNNNNNNNNCGGTGCGTTGACGGGCTTGAACAAGCAGGAG
ACCGTGGACAAGCACGGCATTGAGCAAGTCATGATCTGGCGCCGCAGCTACGCGATCCCGCCACCAGCGTTGGACGCCTCGAGCGAATACTACCCTGGTA
ACGACGCCAAGTATCAGGATGTGGAGAAGGAGCTTCTCCCATTCACGGAGTCGCTCGCGACCACGGGCGAACGCGTGCTCCCATACTGGGAGAACACGAT
CATCCCATCGATCAAGGCGGGCAAGAAGATCATCATCGCCGCGCACGGCAACAGTCTTCGTGCACTCGTGAAGCACTTGGACAACATCCCGGAAGACACC
ATCACGGGTCTTAACATCCCAACTGGTGTCCCTCTCGTGTACGACTTGGACGAGAACTTCAAGCCGATCGCGCACTCGGACGCCATTGCGCCGCTCTCGG
GCCGCTACGTCGGCAACCAGGAGGAAATCAAGGCCCGCATCGCCGGCGTCGCGAACCAGACCAAGGCGCACTAGATGTTGTTGTTAGATTCTTTTTTGTT
TGCATCAAAACACAACACAATCGTCCCCATGTTGAATGACAGATCATGTTTCTCGTCTTCATTGTACGAAGAGCTACAAAACGCTTTTTTGTATGAAATT
CATCTTCTTTCGTCAACAGTTTAGCGAATTGGGTCTTCCTATAATTTTTTTTAACAAATCCCTATACAAGAGCATTGGCTTACCTTACAGATACCGGTAT
ACCGGTACTCGGTACCGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGGAAAAACGCTCCATCGCATTGCACGCAGCATGTGATCCAAAAG
CGTGCATGCCCGTCGGGGACGAGCGCCATTTGAGCTCCACGCCCNNNNNNNNNNCTTCTGCGCGCTCCCTCTGCCCCCCTCGGCCTGCGTACCCACGGTT
TAGCCCCCTTCACTAGTCTGTATCCCCAGCAGCCTCCAGACTTCCAGCAGTTCGCATCAAAGACGCTCTACAAATGAGCGACCACAGCGCGCAGTCTGGC
GGCGACGCCAAAGGCAAGAAGCAGCAGAGTGCCGGCGACGCCAGGAGCGCCGCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCCACCGCACGACGATCCCGCCCGAGGCGACGTTCGACCAACACAACGACCAGATCAAGAAGGACCTCATGGGCATGATCGTGCAGTACCTACAGCAG
GAGGGCTTCACGATGTCGAGCGCCACGATCCAGGACGAGGCGAATGTGAAGCTCACGGAGAAAGTGCAGGACAAGGACGCGCTGCGGCGCGTGACCAAGG
CGATTTTGGACGGTGACTGGGACGTCGTCGCCAAGCTCATCAACAAGAACCTCAAGAAGTTCCACTCGCAGCAGGGCTTCCTCTACGCCGTGTGCAAGCA
GGAGTATCTTGAGCTGATCGACCGCCAGGAGTCCCAGAAGGCGTTCACGTTCCTCACGACCCACCTCAAGCCGCTTGAGAAGATCGCGACGATGACGAAT
CGCAACGAGTTCAAGGACCTCTGCTACCTGCTCACGTGCAAGTCCGTGGGCGAGGTTGACTCGTTCCGCGACTGGGACGGCGTCGTGCGGTCCCGCGAGA
AACTCGTCGAGCAGCTGCGCTCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTAGACGAACTCGTGTCCAGTGACGAGACGAAT
CGCGTCGAGATGCCGGAGAACCGCCTTGTGAACTTGCTACACCAGTCGGTCGCGTACCAGATGGAATTCAGTCGGTACCACCCGAAGACGATCCCGAAAG
TCACGACGCTGCTGCACGACTTTGAGTGCGAGGTGCTGCCGAACGCCGTCAAGAGCACGTACGTNNNNNNNNNNGCCACTCGCAGAACGTCAAGTACGTG
ACATTCGTGGGCCACGACGGCGAGTTCCTCGCGTCCGGCTCGAGCGATACGACGATCAAGCTCTGGCCCGTTGAGTTTCCCCGCGCC