Description :
From Genome Similarity Track
Location :
Scaffold_306:1948- 4325
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_306-snap-gene-0.8Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_306-snap-gene-0.9Brefeldin A-inhibited guanine nucleotide-exchange protein

Sequence
2377 bases(100 bases per row)
CGAATCCTGAACCATGCGATTCAGGTGTTGGACGCGACTGTGAAGATCACTGAGGCGATCTGTCTTGAGTCTCACAGAGGACTGGGCTGCACATaTATCC
GATGCCAAGCTCCTAAGCAACAATGCGCATTGAGAGTGAGTCCATATTtCAGCTATGCCACGTGGCTTCCCACcTCATCcTCTTTTCGATGGTATACTGT
TGATCTGCACATCGAATCGACACCAGAGCCCGGGCATCCGCCTCGAACACCTCGTTCTGTACCTCGTAGAATTGTGTCTTAGCACTCAATACATCCCGAA
GCGTCCCTAATGCGTCTGGCTTCATTCTCAGCTCTGCTAGTCGCcTTCGGCCCTGATGGGGActCTCCCcTAACATAGCGTGTTTCTCCTCGTCATCCCc
ATCGCCTCTAGATGCAAAGACTGTCGCCTGTCGCCtGTTTtCAACGCGTCGACGTAGCTCTACGGCcCTCAaGCCCATGCGCTGCTCCAGGTCCTTCCCA
GACCcGCCCCCcACTCGAGGCAGTCGCCCGCTCATGAGCTCAGCTTCAACTCCATGTGGCTCCTTGCCATTCCTCCTGACAAACAGGAGTGATGGTCTTT
CGTTGCAGTTTCGCATCTTCGTGCAACCTTCACGCAACCTCCGCTGCGTTGAAGAGGCACATTCCTCCCCGACGGAAACGGATGCAGCGCCATCAGTCCA
TACTGCCATCGCGAGGCGTGTGAGACACCATGAGTGGGGCGGCTGTGGACTCGCACGCGGTGTTGGCGCTGGATCTGCAGCTCAGCGAACCACCCGAGAG
GCATCAGGAgaCGGTGGCGGCGGTTGCCGAGACGCCTTTCGAGGCACAACTGAGAGGTGCCGTTGAGCAGTTGTTACTGGAGACGACgCCCGAGAAGGAA
GCCTTTGCTtACCTGCGAGATATCTGtACTACGACGTTGGTTACAAGGGGACGAACCGCTGATGCAGTGAAAGCGGGAGCGAGTaTCGCGGACGCTGGAG
TTGCCGTGTCATCACCGAGACACCCAGAACCAGTGGTAGCACCCAAGAGTCCGCAGGAACGCATCCGAGCTCTCGTCCCGAACGCACTTGACAAAGGGAa
GATTCGTTACGGCCGTCGAACTCAGCAGTGCGTTGCGTGGGTgAATGGAGGAAAAAAaCGTAaTAaGGCTGACGAAATGGGATCGCAGAAGTGGACAAGT
CGACATACCACGATGGAAGACTGTCGAGACGGAGGATCAACGTCCGATTACAGATCTCGTATGTATTTTCACGGGaGACACCGTGCCTGAAGGaTTCACA
AAGGTACAGAGCGAGAACCTTGATACTAGAGGAAATGCTCACAGTCTATGTCGTACACAAAGATTGAACGATCACCGACAGGACAACGAGCAGATCTGAG
CAAGGGGGCGGCGGTGTCTTCGTCTACTTATGCGTTTGTCGCGAGAAGTCTGCAAGCAAGCTGCCCATCAGCGAGATACTTGTCATATTCCCTGATCGTG
GAGAGTTtGTCCCCACTGACTACGAGATCGTTCAGCGAAGAGGCAATCCTGCAAACATCAATTATGTGCGAGCTAGCATCTAATACTGAAATGCTCAGTA
GTCTATCTGACGCGGTGGCTCCCTGATTGAGTAGGGTACCCAAGGAGAACGTATTCATATCTGCTAtAAGCGCTCTATCAACTCCTCTATTGTCGACATC
GCTGTATtGTTtCcTCGGAAAGGTGACAAGCTTCCTTATGGGTGAGTCGATGACAAATGCgTGGGATGTAGCatAACTCACGTTAGCACAGCTTCATGAA
AGTAGACAGAACCCCGGACAACTACTACGCCGATCTGAATGCAACTACTGGTGGAACAGAGGTATTCTTAAGCTATCGGAAAATTctCACTTGTCTGAAA
GATTCCTACTCCCAATGGCTGAGTGTTGCTGAAGACGACCGTGAGACACGAAAGAGCAACGCGTCGACAAGTGAAAGCCCTCGACGGTCAGGTGAGGCTG
AAACGTTGATGGCAGGGCAAATGACAGCGGTGCACTGCTCTATCTCAaCCGAAGATGCAGCTGCGGTTCAACCCATTCACTGGGCAGAATTTTATGCCTA
TCCGCTTCTCCTTGCTTGTTATACACGTCATGGTGTCGCTGCTGACTCTGCGATTCAGTCAATCTTGCAATGTTTTGATACCGGGTTGTTTGATGACGAG
AGTATTCGCTATCCGAGACTTTGCCGACTGGAAGTGGTTGTAGAGGCCCTCACATCAGTCTGTCACCAAGGAGTCAAGTCACGATTTGCGATGATTCTCC
CATTCtATCGGAAACTTGTTAGAAAATTTGGGgCGGgcTTtCCCCAcTCCATTCTTCATGCCACATTGAAATCTCTC