Description :
From Genome Similarity Track
Location :
contig_6:194798- 196398
Transcript NameFunction/comments
g1797.t1hypothetical protein

Sequence
1600 bases(100 bases per row)
CACTTAACTCACGTTTAACATTGTGGTGAGCTCCAGCTTGCCACCTTTGGTCGATCGCGGGATCCAGAGCAAGAGAGACCCTCCTCCAGTTCCTGGGATG
CCCAAGAAACCAGCTCGCCACCGATCCAAGTACAGCGTCTTGCCTCCAAGCGCCGCCACATTCGAGACCCAAGTGACGCTCGTGCCAGCCTTGACCTTCA
CCTGGTCGATCTTGTCGCCCCTGACATGATGTTCACACTAACGTCTTCAGTGTCAGAGCTTTCGAAAGTGATGGTAACACTGCCGTCACCGTTCTTGGTC
CAGATGCCGGCGCTGTTGTTGAAAGCCTTTCCGACAGTTGTTAGTGCCAAAGCTTCCTCAGCGGAGCCGTCATCGACTTCACCGACAAACTCGTGGGTCT
GCAAATGCTCTGAAAGAACTCCGAGACCACACCAGCAATGTTCGTGGGGTCCCAAACTGCCACGAACGTCATGGTCTTGTCCGAAATGCTGTAGGCGTAC
TCTTCGGCGGAGAGAAACGTACCGTTGTCGCTCGTCCCGGAGCTGATGAGATCATCCACGATCCCCCCGAACGTCTTGCGGAGCGTATCTCGCGTAGTGT
ACGCAGTCGTCTCGTCGGATTCAGCGATCAGTTGCTCCATGCAGTTGTTCGTCGCTATCGGGATCTCGTACAGCATGAGGTTCGAGTCGTACATTTTCAT
GCGGATGTCAGCTTCAGAAATGGACGGGTTCGCGCTGCGGAGGTTTGCTATCGTGAGCCACACGCGGTCGGTAAGGCGCTTCATGTCCTCGCTGCAGGTT
GAGTTGGACTTGAGAGCAGACTGCAGCGATGTGATGTCAGTCGCGTCCAGATCGTCGAGGGTATCTCCTAACGTGATATTTTTCATGAAGCTCGTGAACG
ATTCCCAACTGGACACGATGGCGTCCTTGTAGGTGACAATCTCCTTCACGAACAGCTCGATGGTGTTGGTGACTCGGTCTGAAACCTTCATCCCCTTGGA
GACCTTGATTCCGAGACAGCTCATTACAGTAATTGGTAAATCGAACACCACGTTGTCGGTCTGGTACAACTTGGTCATCAACTGGTCGGTCGTGGTCTGC
GGGTCAGTGACCTGCACAGTTCTCACGTATTTCGCGACCTCTTTGCCGCATTGGAACGCAATTTGAACGCCCTTCGCCATGTTGGAGAACACGCCATACG
CTCCAAATGTAGCGACAGACAGTGCGGATCGGGCCACGGCCGTCACCTTGGACAGCATTTCAAGCGTACAATCATCGTTTTGCCGGATACATTGCACTCC
GCACTCGACGGGGTACTCCAACGGACACTGAGCCCAGCAAGTTCCCAACTTGTACTCGAAGCCGATCGGACACACGTCCGCCACATGCGATTCACGGTAA
CACGCCATGTCGACTCCTGCGCCGAAGCCTGGCCCGACCCAGTTGATGTAGGTCGACTTCAAGGTGCTGATGTTGGCCGATAAATTCAAGTCCACGAGCT
CCAAGCTATCCGACGAGTCGTCTTCGTAGTCGTCGTCGCTGTCGTCTGAGTCGGCATCATCGATGGACATCACAACGGAAGGTGACGGGGACGGCGTCGG