Description :
From Genome Similarity Track
Location :
Scaffold_2:1947490- 1950692
Sequence
3202 bases(100 bases per row)
ACAACAACGCCCGTGTTCCCCTGGCTGTCCGGGGGATGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCCGACGGAGTCGGTAGTGACTGCA
AATGAGCCTGCGCGAAAGGCGCAGGCTTCACTCGTTGACAAACCTCGCAAGCACGGACGTACGTGCGCACCCATTTATACTGGTGGGCCCAGTAGAAGTC
CCGCGTGAGAAGAAGATATGCCTTCTCACGGTCCGGATGCCCCGCAGTCGGTGCATCGTGATACTTGTACATGATCCTGAGTCGCAGGTCATGGTCATTG
GGCACGACAACGCGGTCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAACCCGTCGTGCACCCGATAACGGTGTGCACGAGCACGAAGATGCTTCGGCA
GCTTCTGACGAGCTTTGTCAGAAGGCGCTGAGCTGTAGGCCAGCAAGAGTTTCGCGTCCGCGTCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGTGA
CGACGTTGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCATAGTCAGGTCGACGCGAGAGCGCGTCGGCCACCACATTG
AGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCCGTCC
GCAGCGACGCGTGGTCCGTATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGTACTTCATGGCAAGGAGCTCCTTGTC
ATGTACGGGGTAGTTGCGCTCAGCTGGCTTCAGCAGACGCGATTGGTAGTAGACAACACGATCATGACCCTCGTGATCGTGCTGCATCAACGCACATCCG
ATTGCGAAGTCGGATGCGTCGCACACAACGTGGAACGGGCGATCTTGGTCGGCCACTGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCATCGA
AGGCCTGCTGACACTCAGCAGTCCAAACCCGCTCGGCGTCCTTCTTCATGAGCTGGGTCAGCGGGCGGTATCATGCCCGCGTAGTCCTTCAGGTACTTGC
ACAAGTACGTGGTCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTGACCTTCTCAGGGTCGGGGCGGAC
ACCGTTCTTCCCGACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATGAGCGCA
AGCAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGT
CGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCT
CGGCGTGCTCACAGCCGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCATCACGCAGATCAAGAGCACTGTAGATAGTGCTCCTGACC
ATCGAATCGATGATGACATCTTTTCGCGGTATCGGTGTCTGCGCCAGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAGCCGCCCT
GTGGCTTCTTGACACCGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTT
GACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTTGTGCTGGATGCCCTTGTCCTGCGGAAGCTCCGCAGGGATCTCTTCCGGAAGCAC
GTCCGCGTGCTCCCGTAGAATCTCGTAGAAGGGACTCGTCTTCAGCAAGTCCCAGCTCTGCTCCTCAAAGCGCTCCTTCTTAGTCTTCGCACTGAGAGTG
TCCTCGCTCTCAGTGGTGCTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGC
GTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCT
GTACCGGAACCCGGCACAGGTACGTTCAACGTCTCGACGTCCGGCTTCTCGGCCCCCGTCTGCCCGGCAGACATTTCTTGTAGCGTCTCGGCCCCAGGCC
GAGACTTGCGCAGCGACCTTCGCATGCGCCATCTTCTTGTTTTGCGGAGCCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGAGTG
TTGTTCTTGTATACCGCCGGCGGGTATATCCCGCGGCCGAGCGACTTCAAGCCCGGCTTGGTCGCCTGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAG
CATGCACGTTTTTCCTGTGCGGGACGTTTGCAACCGTCCGCACCGCTTGTAGCGTCGGCTCCCGGAACCGACACGCCATCCTTACCTCGACGTCTGTTAT
TGGCGGAGCCCTCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCACCCAAGCCATCGACTCCCGGAGGCGACGGCGTTTCGTCACC
TTGGCTCTTATTATTGGCCAGACCTGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGAGGCGTGTGACTCGCCTGCGTCATCCGTGCCCCTTGAGGCC
GGAGACTCTTCTTGATTGGCTGAAAAGCGGGTGTCAGCCTCCGAGGCCAACACATTTCCTTCATTAGCTGTCAGCGGCAACGCCGACGCTAGTTGCTCTT
GCGCGCGTGTTCGCGCGCGCCCAGGGCACTCCGGGACAGCGGCATATCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGAGC
CATCGCTCACTGTTCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCATCTCCCAGTCGATGACCGAATCATGCCGTGCAAGCCACGGCATGTCCAATAC
AATGTCAAACTTATCGTTCAGATCCAGGACGATAAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCATGCGCTTCTCGGTTTTCCCGACGGCACC
TG