Description :
From Genome Similarity Track
Location :
Scaffold_402:19473- 21135
Transcript NameFunction/comments
g13445.t1POM76356.1 Putative Glycoside hydrolase [Phytophthora palmivora var. palmivora

Sequence
1662 bases(100 bases per row)
GGGTAAAATCGATGGAACCTGGGGCTGGACGACGGCTCAAATGCGTGCTGTGGCTCACCGTATTCAGGAAATCACCATGGAAGAGAACGGTGGTCACCCA
ATGATCTTCGGTGTGGATGCTGCTCACGGAAATTCACTTCTGTCAGACACGGTGTTCTTCGGTCACCAGATCAACGCTGCTGCCACGTTCAACCCGGACA
TTGCATACGAACAAGCTCGCATCACTGCACGTGATGCGCTAGCTGCTGGCATCCCTTGGGTCTTTGACCCCGTTCTCGACATCGTACACAACCCGCTGTG
GCCGCGCGTGTACGAGACGTTTGGTGAGGATCCGTACCTCATTTCCACCATGGGGGTCGCCATGGTCCGTGGTATCCAGAGCTACAACGAGTCGGCCGCA
TGCATGAAGCACTGGATCGGCTACTCGTGGAGCGCGACTGGCAAGGATAAGGACGGCGTGGAGATTTCAGATTATGACCTCATGAACTCGTACTTCCCGC
CGTTCAAGGCCGCTGTGGATGCAGGTCTGTTGACTGGAATGGAGAATTACATTTCCGTGAACGGTGTCCCTGTGATCGAAAATACGAAGCTGATGACGAC
GTTGCTGCGCGAGGACCTTGGTTTTGATGGTTTGATGGTGTCGGATTATGGTGAGGTCAATCACTTGGTCGAATTCCACCGTACTGCTCGCTCGATCCAC
GAAGCCACTAAGTTATCACTAGAGCGAACGTCGGTGGATATGAGCATGGTAGGCACAGGTATGTCCTTCACGAATGCAACCAACAAATTGATTGAGGAGA
GTCCGGAGATCATTGACCGCCTCAAACAATCTGTGCGGCGCATTGTCAAGACGAAGCTGAAGCTCGGCCTCTATGACAACCCGATGCCTGGCGCGGAGTA
CGTTGACATGGTTGGTAGCGATGATGACGTCGCCGCCGCGTTAACTGGAGCTCGCGAGTCGATCGTATTGCTGCAGAACAATGACAGCACCCTGCCTCTT
TTGAAGAACGCATCAGTATTTCTGACGGGCCCCAGCGCACACAACATCGGATACCAGTGCGGTGGCTGGAGTCTCCAGGCGTGGGGGGTATCCGGTAACG
ACATGTTCTCACACGGTGTTTCGGTGAAGCAGGGCTTCGAGGTAATTGCTGCCAACGATTCGTTCACTTACTTCAACGGCCTGAATATAACGGGTAACTA
CACGGATGTGGATCTGGCGACTGCAAAGGAATACGCCAGCCAAGCCGAATATACGATCGCAGTCATTGGCGAGGAGCCGTACGAGGAGAAGTCGGGCGAT
ATCGACGATCTCTCGCTGCCTGCTGGTCAAATTGAGTACGTGAAGGAGCTGGCATCGACGGGAACTAAGGTCATCGTGGTGCTGTTTGAGGGCCGTCCGC
GTCTGCTGGGTGGCCTGCCGGAGAACGTGTACGCCATCCTGAACGGCATGCTGGCGTGTGAGCTGGGTGGTCAAGCCGTAGCTGAGATCGCCTACGGTGA
TGTGAACCCGAGTGGCCGTATGCCTATCACGTATCCCAAGGACTCTGGCAACGTCATGATCCCGTACCGGCACCGCGTGACCACGCAGTGTGCGACGGGC
GACTACTGCGAGCCACAGTGGACTTTTGGCCACGGTCTCAGCTACACCGACTTCACGTACTC