Description :
From Genome Similarity Track
Location :
Scaffold_1:19471- 21133
Sequence
1662 bases(100 bases per row)
GTTACGCATCCGGTTCGAAATCAGGCAGAGCATCAGCGACGACATTCAGTCTTCCTGGCTTATATTCCACGGAGAAATTATACTCCGCGAAGAACGACAG
CCACCTCGCCATTTGCTGCGAGAGGTGTGGACTGTTAACGGCCGTGCGTAAGGACGCATGGTCCGTGTAAACGATGAAGGTTCTACCACCTAGCAGGTAG
ACTCTGAATTTCGGCAAAGCGTACTTCATGGCAAGGATTTCCTTGTCATGGAATGGGTAGTTACGTTCAGCCGGTTGCAGCTGACGTGACTGATAGCAGA
CGACACGCTCAGCACCGTCTGTGTCGTACTGCATTAGTGCACATCCGATGGCAAAATCACTTGCATCGCAGACCACATGAAATGGTCTGTCTTGGTCTGC
AATCGCCAAAACTGGCGAGCGTATCAAGCAAATCTTGATACCTTCGAAGGAGCGCTGGCAATCAGCACTCCATGCCCACTTCTCGTTCTTTTTCAATAAA
CGAGAGAGATGACCAGTCATCTCGGCGTAATTGTGCGAGTATTTGTGCAAATACGCCGCTAGGCCAAGGAAATTTCGAAGTCCTTTTATGTCGGTAGACA
CCGGCCAGTCAGTGATCACCTTGATCTTTTCCGGATCGAACCGGACGCCATGGTTACCCACGATGCATCCAAGAAGTGGTATTTCGCTTGCAGCAAATAT
GCACCACTTGAGGTTGGCGTACAACTTATGCTCAAGCATCAGTGTAAGAAACTTCCGGTCGTGGAGTCGGTGAACTTCCAATTCCGTCTGTCCATCCATA
GCCCGGCTATGAAAGAACACATCATCGAAATAGCTAGGTGCGAATTCTTGCACATATATCAACAGATTCGTAACACATCTATTGAACGTATCAGGGGCAT
TACTCAGCCCTTGTGGCATTACCAACCACTCCCAAAGCATACCGCTTGGGGTGCTCACTGCTGTGTAAGGAATGTCCTTTTCACTCATAAGGATCTGATA
GAACCCGTCCATCAGATCCATCGATGAAAAGATGGTACTCCTTGCCATACCATCTATAATGACATCCTTTCTTGGTATCGGTGTTTGAGCCGGTACAGTT
GCAGCATTCAACTTGTTGAAAGCATGTACTATCCGCCATCCTCCTGTGACCTTTCGGACACAGAAGGTCGGAGAGCTATGAGGGGAAGTAGATTCCCTCA
CATGACTCGCTGCCAACCGATCGGCGAAGAATTTGTCAATCGCTAGTACTTGTTCACGAAGCAGTGGCCATTGCTTCATGACACAATAATTTGAACCTGG
TTTCAGGCCGATCTCATGACGAGTACCCTTATCCTTAGGTAGCTTGCACGGCACTGTTCTGGGAACACATCTCTGAATTACGTCAAATCATCGTAGAGAG
GATTTGTCTTGAGCGATTCCCACGATTGGGATGTATATCGATCAATCCGAGTCTTCTCATCGAGGACACTCTCGTCCATTGAAGAACTGCTGAGAACCCT
TTCGTTCTCAGCAAATACCATTGCCGACCGAATATCGATTACGTACTCGTCTTCCGCGACGAGTACGCAAATCTGCTTGACTTTGCCACTGCGCAGATCA
TGCATGAACCTCTTCTGTTTGAGCGTTGGCAACTGAGTGATCTCCGAAGTTGTCTTCGGAGG