Description :
From Genome Similarity Track
Location :
Scaffold_252:1947- 10152
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_252-snap-gene-0.5GK22865

Sequence
8205 bases(100 bases per row)
GCCTCAGCTGTTTGAACCAGCGGCCCGACTGGTGCGTCTTGCGGCGGCTGAACACGGCGGTCGCACGGCGTCCGTGGCGCGAGATCGTCATGCTCGACAG
CAGTGAATTGGGTCGATTACTGGACGGCCCACGCCACGAGTCGAGCAACGAGTTGCGCCGCGTTGACGGCATGCCCGAAAGCGAAAATAGCATGCCCGAC
GTCTGCGAGGCGTCGATCATGCGAGTGTCGTCTCGGTCCATGAGCTCGGCAATCGGCTCAACGTCGCTCGCTCTCGGTTCAGACTCTTTCGTCTCACTGT
TAGTATCGTCTGCCAAATGCGAGAGACTTGTCCGGCGCGACTGGTCCACAATCGTCTCGTCTTCGCGGTCATACTGCGCGGCCTTTGTCGAGTGGTATTG
CCTGTCGACGGGCTCGTACGTCGCGCGGATCAACGACGCGCGCGCCACCGGCTGCGAAGGTTCTTGAGACGCGTCTACGCCATTCACAAAGCGGAAACTT
CGGGGCGGAGTCGCCATCGCGTGGATCGTCTCACCGTCAAACAGGTACTTGCTACGTGGCGCCGGCGGCGGCACCTCCGCACCCTGATCCACATCGCGTT
CGCGTTCTTCGTCGACATTGAACGTTCCGAAAAGGCTCGGGCGATCACGCCCATGCTCAGCATCGACGTCAAAGCTGGCGTGGCTCATCATGCTTTGGTG
GCTCATCATCATCGCATCAATGTCGACTTCGCCCAGTCGCGACGGGCGCCCGCCGCCAGCCAGTGGATCCGTAGCTTGTGGGTTAATGCCCAAGAGCGTC
GCGTTGTGCCAGTGAGCACTCATGCGCTGGAAAAACGACTGCGACATCGGCCCATCGCGATGCATCGTCTCGTTGCGTCGCTCGGTCTTGATGATGCGCA
AGATGCGGTTGATATTGGAAAGCACCTTGGCGTCGGTCGTGTCCTTCTTTTCGCCAACCACCGTTTCCAGGTACTTGACCATGGACGAAAAGTACGCGAG
GTCCTTGAGCAGAAATGGTAGGTCACTGGCCTGAGCTCGGGCCTCCAGCACACGGCGAAGCAGCTTGACGAGCACCGGGATATCCGGATGGTCCACAGTG
ACGCGGCAGAAAAGCAGCTCCAAAAAGTCCTGCGACTGCATGCCCTCAAAGTTCGCGAGCTGCCTCGCAATCCGGAGGGTGCACCGGTACGGGAACCCAG
CGACAACGAGCTTGTTGCAGTGGCGCACGAGCTTGAGCACGTCACCGGGCATGTCAAACGCCTCGATACTCTCTTCGATCCCCAGAGGGGCACGCAAAAT
GTGGGTCATCGCCGTCGTGAGCTGCTCAACTTCGGCAGCGAGATCCTTCAAAAACTGCGGCGGGTTTTCAAGATCAAAGCCCATGAGACAGTGCAGCTTC
TCCTTCCACTCTTGGAAAAGCAACTCGAGATTGTACGCCGGATTCGTCAAGTCTTCCGGGTCCGGTCGCGCGAGGAAATTGTCCAGGTACAGCCCGGCAA
TAAAGTTCTCGGGCATGTGAACGTAATCGTCGTCCGTTAAAATGACCGAGTCGCGCTTGGCCTTGGACCGCTCAATGCGATTGCGACAAATCACTTCGTC
CAGCGTCCGCCGCACCTCGGTGCGCCAGTAGGAATTCCAAATGAGGTCGCTCTTCTCGTGGTTGTCGTCGAAGAATTTCCCCGCCAAACTCGGGTCCAAG
TGGATCTGGTACACGATCGGGTACGGCAAGAACCGACCAAGCCCGCTGTACATGCTCTCGCGCACGGCGAAATCTTTCGTCAAAAGCGCATACAGAACTT
CAAATGCCGGTTCGCGCAACGCCTCGGCGCGCAGGAAATGCTCGTGCAGAACATGCTGCCGCGACTGGATCGCAATGCCCAAGATCTCGACCCAGAGCCC
GCTCATCTCGACGTACTCGGCGACCACGAGGCACGTGTCGCACAGTTCGGCGAGACACGACAGCGCGTAAAAGGCCTGCTCGTAGTCCAAGTGGTCTGCG
ATCACTTGGAGGCTCCATGTGTACCGGCAAAACGGCGCAAACATCTTCTCCAGGTCGAACTCGAGCCCACAGAGCTTGTTCAGGATGAGCAGCGCAAACT
CCTGACGGTTCAAGTAGTCGACGTTGCCAAACTCGGCCTCCATACCGGGCGGCAGTCCATCGAGTTCGGCTTGGTGGCGGCCGTTAGTCGAAGTTAGAAA
GCCGTAGCTCGACAGCGAGCGCCTCGACGAGATCGACATACCACCTTTGTCCGTGCGATCGAACGGGAGCAAGTATCGTCCAAGTGTCGCGACGGAAACC
GACTCGCTCTCGCTATCTTCTGCGTCGGCGTGCTGCTCCAGCACGTCGACGATGGCCTCCTTAAACACGGGCAAATCCACAAGCACGTTTAGGCATTGAA
GCGCCGGTAGCGTATCAGCATAGATGCCCACAGTCGGATCGCGGTTCTCGTTGAGAAAGACGAAAAGTGCCTGCACAAAATCGTGTGGCGTCGACGGGTA
CAAACAGTCGGCTGTGATGGCCTCTTCTTGGTCGCTCTCGCCCATTGCAATCAGAATACGCAGGTAAATGCCGCCGACGAGCGGCTCCGACTTGAGACAG
TCATACATGTAGCTTGTCGCAGACTCCAAAAACAGCAGCTCATCGTCGTCGTCGTGGTTGTGGCCGTTGCAGTGGTCGGCAATCATTTGCAAGAGCTCGC
TACGCGTGGTTCCGTTCCAGATACACGTCGGCGCGCAAATGTCGGTGGACAAGATCATCCAAAAGTCGTGGCCGTTGGGGCGGTCCAGGCAGTCCAGAAA
CTCGAGCGGCAGGAGATTCGCGAGTGCGTCGAGCCCCTGAGACCGTGACTGGCCATCAAGCCCCAAACTCAACGCGCGCAGGGCATGGAACGCGGCCTCG
ACGACGTCTCGCTCTTTCAACGCGACGATCTCACCGTCGTCACTGCTCGCATTGGAGGCAGGTCCTTGAGCGACGTCCTCAGCAGTACTTAGCAGGAGAT
AGAGTGCTCGCCAAAACAGTTTGGTCGATATCACGAGCTGCTCTTGGAAGTNNNNNNNNNNAGACATAGAGTGCTCGCCAAAACACTTTGGTCGACATCA
CGAGCTGCTCTTGGAAGTGGCGGTTCGCACACAGCGACGCTACTACGCCGTAGAGGACTTTCTGGATTTGCCATGGCTGGCGAGCTTCAAACGAGGTCAG
CAATTTCTCAAGCGTCTTGCACAGCCGTCTGGACTGCGTAGTTTCCATGCGTTGCGACTGCGAATGGAACGTCGGACCGCCCGCAAAGAGTGACGCTCCC
TCGTCGTCGGTGGTTGTGGTGTCGCTGACGTCCGACAAGAGTCGAGATGGCGCGGGCGTGGGTGTTCTACAGCCGCCACTACGAAGTAGCGAGCGTGGTC
CATGCTCGGACGATACAATGATCTCGAGAATACTAAAAGCAGCCGACTTGGCGGCATAGTTAGTGGACATTGCGTAGTGGTCAACCATGTCGAGCAGGCG
GTCCCAGGCGCTGTCCAACTCGAGCAGGCTCAGGATATTGAGTGGCGCCGACGACAGCAGCAGGTGCAAAATCTGCACGCACAAGTCGCCAAACTTGGTG
TCACTGGTGATCGAGCTCAGCAGCAACGGCAGCGCGCGCGACTCGTATGAGAAGAACTGGAAGCTGAACTTCTCAAGTAGTCGCAGCTGTGAGAGCAGAA
TGCACTCGATGACATCGTCCGACGTGCGGCCGTTCGCGCGCTCTTGCTTGCGTTCCAATAGGGAGCTCAAACTCTCGTACGCGGCCCGCACCGTGGCCAC
GGCGGCACCTTTCTTGCACAGGTCACGGTACCGTACGCGAAGTTCCGTCATGGTATATAGCTGGTCGCTTTGCCAGCCAAACGTCTTGAACGCCGTCGCG
CTTTCTTCTTCGACGCTGTGGAAATGCGATGACGTGTGGCGCTCGCGTAGCGCCCTCCACTTCTCTTCGATCGCGCCCATCAAGATCTGCGGCTCTTCGA
TCGCGTCCAGACTGGCATTGTCGCCATCGGCGATCGTCGACAAGAAGTACCCGCTGCAGTACACGTCGCGCGACAGCTCGTGGTACTTGATGGGTGGTAG
CGACACATAACGATACGTCGCAGCGACGTCGCGCTCTAGATCCTCGAGAAACTCTTCAATGTGTTCGCGCACCGTGAGGCGAAGGTGCTGACGCATCGAC
GCTGTCCACAACACACGCTTGTCCGTGGTGCGACCCGTGAACACATCGGCAACAAACTCGGCTGACTCACTGTCGAGGAGCGCAATGAGCGGTTCGGGGA
GCATATCGAGGAGAAAGCTCTGGCCTGCGCGGGTCTCGCGGCAATCCTGCACGCGATGGAACTGCTGTAGCAACGTGACACCAGCAACAACGCTCGCGGG
ATCTGTTGCGCCCGACTCGGTGGCGAACACGAAAAAGAAGAGCCCAAACTCAAAGAGCTTGGGCCCGCTCGCCGGTCCGAGTGAGCGCAAAATCTCGCAC
GTCAGTGTACGCACTGCCGTGTCGTCGACGAGCAGCAGCTGTACGAGATGCGCAAGTGTCTCTTTGGTCGAGAGCAGCTTCTTTGCCATCGGAAGTGGGA
CCAAGTACCCGGAACTGGTGCCCATTGAACCATTGGGTTCATTGCGAACGGCATTCCGCACAATCGTCAGCGCCTGTACGCCGACCGCGGCCGCATCCAA
TGGCTCGGCGACCAGTTCCATCCACCGCAATTCGGGTACTTGATGCAGCACACGCCACTCGTGCTCGCTGCTGTCGTGTTTGTCATGGATCGTGCAGCAA
CACACCGTGACTTGATGAAGAGGAAGGGACGCTGGGTGCGATCTTTTGAGATATTGGTGGAGATCCAGCGCGGACATGGGGCCGTCCGCATCCTCGTCCT
TGTCTCCATTCCGCTTGCATCTCCAACGCAGCGACAGTCGAGAGTTGCCCGAGAACTGCGTCATCGGGATCGACGAGATGCTCGCGCACTCAGACGCTTC
GAAATCGCAATCAATCACGGGAAACTCGTCGCAATCACCGATTGTCGCCAGGCCGTTCGGGCGACCGTGGTGGCGACGGTGTGACAACACCGCCAAATAC
ACAATTGTGCTGAGGTGCAATTGCTTGATGAGATGGCGCGTCGTTGTGCTGTCGGCACTGCAATGCGCCAGTAGCTGGATGAGGTTGCCGACTTCACGTG
CTTCAAACGACTGGTTCACGAGCTCCAAAAGGAAATCCACACGCGACGACGGCATCGCGCGAATGCTGGGAAACGATTTCGCCATTTCAATCAGCGTCGT
CATCAATAGTTCTTCGCCAGCCTCGGCAGCGGGCTGCGCACACAGCTCTGAGAGGCGTAGCTGCGAGCACTCCATCGCATGGCTGCCGCCCACAGACGGA
CCGCGGAGCCGCATCTCGAGCCACCGCTGGTACACGGCATCGTAAAATGTTCTCGGTGCCACCACGATATCGCCAATGGAATGGAGGATCTGTTGTGCTT
CACCCGTGAATCCATGGTGGTGGCCACCATTCGCCATTGCCGCCACCGCCTTTCTCGCTTCGTCAAGCTGGAGCGAACCATCACGAACCCGAGCGACCAG
TACGCGAAGGAAGACGTGGTCAATTTCGATCTCGTCGGCAATCGACGGGTATTCGACCATAAACTGCCAGCGGTTCCAACACAGTGACGGCTGAAGCTTC
GTCGCACCGCTGGCTACTCCGTCAATCAGACTCAGCGTCCGCTCGAGCGCCGACTTGAGTTCCTCTCGCATCCGGCCGTTCCAAATCACGTCCGGCAGAA
AAAAGTCTTGCTGGAGCAGCTCAGCCAGCAACGCCACGTCACCATGGCACTCTCCGGCGTAGTTCGATCGTGCGCCGTCCTCTCTCACTTTGGCGTTGGA
GTCACTGCCGGGCAAATGCGTGGCGATCTCTTGCCGCATACGTCGAATAAACCATTCGGACCCGCCACCACGAGCCTCATCGCGGTGCTTTTTCTTCGTC
TTTGTCCTTTCCTTGCCGTTGACACGCTTCTGCCCGTTCTCGTGGAGCTGGAGCAATGACTTCTTCACGACCGGCGTTGAGATCATGCGGAGGAATCCGC
GTGGCAACAGACTCTGCAACAGCTCAAACGAGGGCTTGTGGTGGACAATCCACATGGCTGCAATGTACTGGAACGTGAGCCGCCCAGCCTCGGTCGGGAA
AAAGAACGCGTTGAACAAACTCCGCAGCGTACGCCCGCTCTGAAGCGAAGCGTCACACATACGCTGATGGGCGTGCACGTCCGTGTGGTCCAGCGTCGCC
CGCAGTAGCCCTGTCGCAAAAACGGCAACACCGACGACCGTCGTCTGCGCTGCCATGGTCTGGAGCCGCAATGAGTTCATACTGAGGCGCTTGATGATCG
CGTCAAAGTGGTTATTATCCGTGCTTGCGCGACCCTTGACCAGCACATCGTACAGCAAGTCGAGTGCCGCCAGCGCGCACAGCGGCTGCGAGTCGCGTTC
CAAGATCCCGACCAGGACGACAATGAGTTTGTCGTGACCCAAAACCAGTGCGCGCGTTGCTTTCTCCGCTTGCTTATGGCTTGGTGTACGGCGCGAGTCC
ACGGCGAGTGAGTGCAATGCGCGGATCGCCCACAGCGTGGTCAGCTGATCTGCCGCCTCGATCACCATCGTCAATCGCTTTACAAAGGAGCTGATCCGCT
CGGGTGTTTCGTCACTCGCAAGCCGATAGCAGCCGTCATTGACCCGGCAGAATGCTTCCAATACGATTGCTATCTCATTGCGCCGCATCGGCGGCTTTTG
CGCATACTGGAGCTGTAGAGGGCAAGGAAAAAGCGTCAGAAAAGGTATTTCAACGACACAATCTCAGCTGGTAACGTACCATTGCCGCGAGTCCCTGGAA
CATCGTGCGAAAACTGAGCAGGGCAATCTTGCCATCGGCGGTCGATCTGAAGTCGTCTTCTTCGACATTGTAGTTGAGATTCTCGAGACCAAAGAGCACT
TTTTCAAACAACGCCGAGGTGATAGCCGCGCTATCGACCGAGAGCTTTTCGAAATCCTTCGAGAGCTCACGAAACATGGACACAAACATGCCCGTCTTGT
TGAGCACGACCGCTCGCTCATCGTCGCGGCGTACCAGACTCCGTGCCGTCAGTCGAGGGTTCACTCGCGTGAACGCTGGGCTGAGCGTGACCCAGGCGTT
CTGGCAGTACAGGCAGCAGTCGTACAGGTTGGCGAGCAGTGATGCATCGTTATTCGAGAGGTACGCGATACGGTTCCCATCCGCAAAATCCAACGCGATC
ATTATTGGCACTTCATGGTGATCAGTGTGGGGGCTGGGCACACAAACGAGGCGTCGAAGCTCCTTGAGCGAGTACGACTTTTCCGTGTGCTTGTCGAGGT
CAGCTTCGAGCAGCATGCCGTTCATGATGCCGATTTGTTTCTTGCGGAAGCGGAAAAAGCCGTGGCGACCGCTTCGTTTGACAACGTTCACAATGCTGCG
GGGGTCCCATCCATCTAAGGTGGGGGCAGACGACGACCTGCGCCGTGCCTCTGCAGTGGGCTTGGGGAGTTGCACCGTCTCTTCGCAAATCAGGCGAATG
CCGACGACACCCGCGAGCTCACGCATCTTCTCGAGCATCTGCGTGCGCGACTCGGAATACACGTACAGGTGCTTGCCCTTGACAATGATGCAAAACGTAT
CGCGGGGTTCCGATGGCACGCATAGACGCTGGATCGACCGAAACTCGAACTCGTNNNNNNNNNNCGCAGTGGGCTTGGGCAGTTGCGCTGTCTCTTCGAA
AATCAGGCGAATACCCACGACACCCGCGAGCTCACGCATTTTCTCGAGCATCTGAGTGCGCGACTCTGAATACACGTACAGATGCTTGCCTTTGACAATG
ATGCAGAACGCATCGCGTGGTTCCGACGGCACGCATAGGCGCTGAATCGACCGAAACTCGAACTCGTGGGTGTTGCGATTCACGAGACGCACAGCGACGA
GGGCGCGCGGTGTGAGGTACAGGTCGCTCTTTTCGCGCTGCCCGCTGGTCTTGCCCAAGAACCCGCTAAACTGGACGCATTCGACCGCGAAGACCCGTTT
GAAATCGTCAAAGCTGCCAGCAAGATGACTCATGAGCTCTTGCAAAAAAACATTGCGGCACCGGTACCGCAGCCGCAGATATATGGGCTCCTTGTAGAGG
TCCAT