Description :
From Genome Similarity Track
Location :
Scaffold_33:194679- 196955
Sequence
2276 bases(100 bases per row)
AGCACAAGCGGAAATCCCTATTGAATACCCGAACTCACCGGGAGTATCTGGGACTGGTCTCCGCTTACAACAAAGAGGGCTGACGTGCCGGTGTGGATGC
ATCGAGTGAGGTTGACAAACACTTCGTCCAACTCGAACAGCCGCATCGATTCGAAGAGTAAATCTCGGTCTACCGTATCGTACGCCTTACGAAAGACCAA
AAGTAGGATACACCGACTTTTCTCAGCCGATATGTCGTCCTGCACTGCTGCAGTCTTGATCCAAGCCTTCATCATTATAAACGACTTTGCAATTTTTAAG
GCCGAAAAAACGTTGTTGCGAGTCGCTTGTAGTCCTGGGTAAAGCGTGTTGTAGATGTGTTGCGAGAACCTTTGTAAAGGCTTTGTAGATTCTTTGCAAT
AATGCGATCGGCCGATAATACATGGAATCGTCCGAGTCGTCCTTTTTACGAAGAGGAAGAACTAGGGACTCAAGGAAGGAGGGGAGCAACTCCGACCCCT
CGAGTATTTTGTTCCTGATATTAACCAGCGCTGAGACCATGACCGATGTAGTCTCCTTGTAGTAGTCGTTGTTGAGCCCATCAAGACCGGCCGATTTATG
TTGATTAAGCCCTTTGACAGCAGAGAGCATTTCTGCTTTCGTACGGGGCTTAACTAGCGTTCATTATCGTCAGCTATTATCTGGCGGTATGGACGCGAAA
AAAATCTCGATTCTTGAAAGCCAATAGAGACAAAGAAGTGGTGCAATGACTCTGACTCAGGACTGATTCCTATTCAGATGCAAATTGATCCGCGATCGAC
ATGGTGCACGTAAATTCATGTCCGTAACGGGCTTGAAGGGAAGTTACGCGCTGATCTCACTCCCAATTAGCAATATGATTGCAGGAACAAAATAGTGCTC
CGTCGTCCGCGCTAAAAGCTTTTGAAGACAAGCCAGGTGGTCCTCATGCATTTCTTCTACATTAGTGGATATCCATTGCTGTCGCGTTAGGAAAACGCCG
CCTGTTTAGTTGGCGGAGCTTTGCAACCGAGCATTTTCTCCGCAGATGTTTCCATTTTTGCACCACCTTGATAAAGTGTATGCTCTGAGCAATATAAGTA
TCCCGGACCAGACAGAAGGCGCTTGCTCCACACCCGAGTCCATCATCTCCTGAATGATGTCCTTTAAGACGCGATGGGGCTGGATTGAAATGGATAGGAT
AGGAAAAGTGATCGGCTACCCAAACGCTTTCCCCGTAAGTGTAGCACCACTTGCTCATGATCGGACGGTTGTGAAGGGGGGCGTAGATACCCACAGGACG
TCCAGAGCCCAAGAATCAGGAACGAAGAATCTATCAAGCTGACTAGCCGACACCTCGCTCCAGTACGTGTAGTGATGACTAGTGTATTCGTCGTAATTCG
CTGAATTTTCTTGTAACAGCCGGGCACCACTTAGGGCCGCTCCTTCAACAGAGAACCCTGTTTTGGACTTTCCGGACGGCTCTCTGTCCGCGGGCCTAAC
CGATCCAGTTGCGGGCTCTGGACACAATTGAAGTCGCCCAGCAAGACAACGCTACTGGACGGCATGTTCCTAACGCGGCTCCCACGAAAATGTCCTCGCG
CACAGCCCGAATATTTGGTGCGTAAATGTTGATGATACAGGTGTCGTAAGACATTTACTCCAATCACGAGCGAGGTCCATTTGTCTTCGTTCCGGCCTAC
TGCAGATAGATGTGCCGAGGGTGTGTGAAGAATACCAGCCCCTCGGGCCGTCGAAGATCCCACACTATAGAAGGAATTAGGCGCTTTGTCCACGTCGAGC
TGTCCTCCCCACATCCTTCTTGACCCGAGCCGCAATGCCGTTGCTTCTTCTGCACTGACCACATGTGTTTCTGGATTGCACCACGTCACCGGCCGTAGAT
TCAGCGACGTCTGGCGCCATGATGTCATCCACGCCTGACGTGTAACTTTTGAAAAGCCTCGGATGTTTTTTGTGAGAATTCGCTGGTCCGGCTCCCATCG
TAATCAGCAATATATTTGGCGGACTTGGATTCGAAGCCATGTAACACAGTGTGACGCCCGAAAGCGTCCACGAGGTCAAGCTCCGACCGGTAGTAGCGCA
ACCGTGACGAAATTGTGATTTGCTCTTAGTACAAATTTGTATCCTTTTCCTCCGTACGTACAATCCGGCGTAGAGGAATCGTATGATTACCTCCCAATTT
GAAAAGTGATTGGAGGTGCAATAAGCTTTTTTGTATCTGTATTGTCGAAAAGTTGTATATGGTCCCGTGGTTTGTT