Description :
From Genome Similarity Track
Location :
contig_36:194661- 196698
Transcript NameFunction/comments
g9182.t1hypothetical protein

Sequence
2037 bases(100 bases per row)
AGACCTTGCCCGGGAATCTCAATATTACGGCTCAATGGAGCATACCCAGTCCGAACTGGGGGAGCAGCCAGTGTCGGAATTTGATCTCAAAGAAGAGCAA
ATACTGCCACACCGGAGGATAAGGGACCAGCAACCAACAGGTCAAGGTAGTTGAAACCATACTCCAGAGAAGAAAAATCGACAAAAAAAAATAGACCGAA
GAAGGCCAAATCGACCCGCGGACTTGAGGAATTACTACCAGGAGGTCTCTAGGTCAGACAAGGACAAGAAAGTCCGACAGCAATTCTAACAAGACGACGA
TGACAAAATCCGGCAGTGGAAGATAGTGGAAAGTGACGTGATGCTGAAGCCTTCACGATTCCACAATAACGATATAACTCACGGGTTCATCACTAACAAT
GTCAATGGATTTGGGGCGACGGAAAAAGACCGCCAACAGTGGTTTAGTGCATTCGGAGAATCCGATGAACACGGACAAGGTGACGTGCGCATACAGAACG
TATCAGATTGGAACGGGGAGTCACGACTCGCCTGCGCTGAGGGCACTATTGAACATGTGGAGAATATTAGATCCAATTGCAGTGGCCCGACCATCACGAT
GGACTAAAGCAGCGCGGCAAGTAAAACTCCACCAGCGGTGTAGGGCATTGTAGCTCGGTGAATAGCTCCACAGGATTTCCGATATTCTAGCGAGGGCACG
GGTGTGTGGTTTAGGCTTGACTGTACCATGCGTACCAGATAGACCCAGTCCTTGTAACTGATCTTGTAGGTTAAGATCATCGTCCTCATCACTTGGAGGA
TGACGCGGTTGAAACGCTCGATGGATCCATTCACCAATGTGCTGTACGCAGGAGTGAACGTTTGCTGTGATCGCAGACGTCGGCTGAGCTCGGAGATGAT
TTCGTTCTTGAAGTGACTCCCGTTGTCTGAGACCCATACGGGCGGTATCTCGAATCTTGAATGCCATACCAGTAGGGCATCAATCACCACGAGGCTGTCT
GCTGTGTCGGCCACTACTAGCTCGCAGTAACGAGTGGCATGGTCCTTCAACACGAGCAGGTACTTGCTGTTGCCGTAGCTCTCGCCCATGTACAAGTAGT
CGAAGTGTAGGACACCATTACGCGTGCTGCACTCAATCACCTCACTCCACGGGCGGGGGACAACCTTCCCCCCTCACGAATGCAGACAGAGCAGACAGCC
TTTGACGAAGCTGCCCACAACGTCCGCGATGTGGTTGATGGCGAAAAGTCGGCGTAAATGTGCAATCATTGCGTGCTGGCCACGGCGACGTTGAGCACCA
CAATGGGCTACGATACAGAGGCGCAGTAGAAGGGAACCGGCCTCAGTTGGTATCCACAAGCGGTTGTTGAGAACCACTAGACCATTCTCGTCCGTGTCTG
CCCCAGCAGAGGTTGGGTGCGTTGATTGTACTTCTCGGAGCTCTCGAAGCGTAGGCCAGATGAAATTGTCGTCGTCCAGCGGTCTCAAGGCTGAGACGGG
CCTGGGTTCGGACGGTGAGAGGCTTCGAACCGCCTTCAACCGCTTCACCGAGACGGATGGCGTATGGTTGCCGGTCCACCGGGAGATCATGTCGTCCCAC
ACTTTGTCGGGTGCTCCACCACGTAGCGATAGTTTATTAATATCATCGCCCAACGTAACAGCTTCCCTCTCACGTTCTTCTTCACCGACTTGTCCGGTGC
GAAGACATGGATGAGGTTACGATGGTCACAATACATGCGGAAACGCTTGGGCTGTAGAAGTAAGTAGTCCAGCTTGTCACACGCCACTGCAATGGGGAAA
GCCTCCTTCTCGATGACAGTCCAATTCAGTTGGCTGCCAGTAAAGGTTCCGCTCATACAGAGTATCAGGCGGTGCTGCTGTTCTTCTTCGAGTCGAAGTC
GATCACTTGCGTGACGATGATTGCGTACCCGACGTCGGATACATCAGTGAACATACTGGTGTAATGGGTCTGCTTAGACCCACTACTATAGCTTACACGT
GTGCGCACGTGTATGAGGAAGTGTAGGAGTAATTAAC