Description :
From Genome Similarity Track
Location :
scaffold_26:194660- 197671
Transcript NameFunction/comments
Plaha_PHALS_04924hypothetical protein

Sequence
3011 bases(100 bases per row)
GTTGTCAAGATCCGTTCAACGCTATTACATATCCTCGTTAACAATCGCTTATGGGTGAGTAGAATGTCTTGGTCACAATAGAATGTCTAATTAATTGTCG
CTCCTAGTGTGTAGTTATATCTAAGGTGCGAATCACAGACGTCACAGACTACTGCAGACACAATGCAAATGGCGTTTGTCAGATCCTGATATCCACTGAA
AATGGCGATATATGGCTCGTGACGTTGCCGAAGCAATTTCAGCCTGCGATGGGATGTGTGGTGACCAAGCTCTTTCTAGAAAGGTCGTCGGATCAGAATA
ATGACGGAGGTGTTCGGTGGATTGGTTTAGTGCCGGGAGTGCTGTCGGTATTACACACACCAGCTGATAATGGAGTGCTGTCGCTTACGTTATTTAGGAG
CATGGTAACGCCGACCACATTATATGTAAATACTTGTGAAACACTTGAGCGACAAATGCCGAGTCACCAGTTAATAGAATTGGATGATATCGAAGGAGAA
CAAGCTACTTGTAATTTATGTTTGATTGGTCGGGTAGTAAGCCATACGGGGCTGCTCTGTGGCTTGTTTCCAGACGTAGTGAACGATTCTAATGTGGCAG
CTATTCTCCAGGGAGATCTTGATTGTTGTGTGCGATTTGCATTGATACGATTTTCGAATGCGAACGGCGATTGTGCAAATGCGTCTGTGATTCGCAGCGA
AACACTTCTACGGTTGCGTGAACCCATTCAAGCAATCATCCCATTCTGTACTAGTTCTCCACGTTCAAACGAAGATATTGCAACGGTAGATTCTCAACAA
TTTGATGCACTGCTAGTTTTAAGTGTCCGAGGTAGGATTGGCGTGATCAGTACGAAAGATCGCAGAGCTCTCGAGACCTTTCCAGTCGCTGTGAACACCC
TGGAGCTTGGACGCTCGGTACAGTCTATAGTTTTTGTGCACAGTTTGAGAGTGTTTATTTTTTGCTCGAGTGGATCAGCTTTCATGTTTCGAAGTATTGA
TCTTTTAGCGAAAGCCGAACTCGCAAACTCTAACGCTGTACCAGCCTCAACGACTAGATGCACTCTCCCAACAAAGAAACTACCCCTTCAATCAGTAAGT
GCTAATATCTTACCTTAACGTTACTATTACGATAATGTATTCACGAAACTTGCGAAACATGCAGGGTATTATACACCTGGCAATTCATGGTCGTAATGGT
GGCATGTCGATCCTCTTTGCGTCAGGACGGACAACACATTTTGACAAGAAGGCGCTAAACGATCTAGTGACTAGTATTTTGCCCTGTTTCGAGCGAGAAC
ATGTCCCGAATCGTGGTCACACAGCAGCGGTCGAGAAACTATCAAGTGAGTCTCAAATTCGAGAACTTGTGCATCGTATTGCTCAAGTCACTGCCGAGTC
TTCTGATCTCCGTACAAAATCGAAGCAAATGGACGTGTACCTGAAGGCTTTGCACTCTGCTTTGGAAATTCTTCGAGCTGTCGGAGCTGCAGGTTTTCTC
GTTCGTGTGTGATGCTCGTAATAGTTATGTCAGCTCTGAGTAAATGTGCCTTTGCAGGTGTCGAGTCTGTGGTTAATAGCGAAATTAGAGCCAATGTAGT
CAAAACAGGTACCTTTTTGGATCGGCACACAATTCAATTGACCTGTTCACTTCGTTTCGTTGATTCTGACCCTAGCATCTCACTTGACGAATGGTAAATG
CCTTTATCAATCTTACGTAGGTGAACCATCAAATTTTGTCGCTAATTTTCGTAAATTCAGGTCATTGTGTCTGTATGTGCGTGCCCTCGATCGCGAAGTC
ACGTCGTACTCATTTCCGCTGAAAAATATAGCAGCACATGGAAAACAGCGTATTCTTCTCGATCCGGATACACTTGCACAGCAAGACCAGGGATTTCTAT
GGGTTTCGTGCTCTATGGTATTTTGTCTATCTCTAGACGGAATATCATGTCATCAACATCCTCAAACGAGCTCAATCGACTCCCAGGCCATTCACAAGGA
CAATTTGCTCGCATTTGCTATCCCGCTGATTCAGAATAAAAGATTCCTACTTGCACAGCTAAGTCAGCCCATCGAGGATGAAATGTCAGCTCGTCAAGGT
GAAATTCATGCTGCTTTTTGTCAGCGACATGTGCCGTTTATGCCAGTTGGCAAGACAGAGACGCAGATGTCGAACCTTTGGGCTGGTGTGCACTCGTGGG
CTGCACTTGCTGACCATGCTCAGAAGACGCCATCGTTCGCTGCATTATGGTCGAAAATTGCGTCGTCTAATGTGGCAATGGCTCCACCATCCCGCTTTGT
GGTTACAATCCCCTCATTTTTCGACACtgaagacgatgaaaatGAGGACGATGGTGAGGATGAAAAGTTTGAAACGAATTGCATAGAGAGAATGGTGTCA
TTCCTGCGTCAGCTGCTGGACACACCCACTTGTGATATCCCACGATTGCGTCGCAGCTGCCGAACACAACATGGGAGTCTCTGGACAATGCTACAAGCTT
TTTCGGGAAGTCTTGTTCTCCTACGTTTTACACCTTCAGAAATCGAACCCCAATCCGTTGATTTGACGATTCAATGTTCTGACGTGGCTGATCTCTCTGC
AGTAGGTCTTCCCATCATTGTAGCTAAGCTAATATCTAAGATATTAATCAATTTATGCAGATGCGAGCTCTTGTGCTTGATATAATCAACAAATGGAGCA
GCGGAGATTTAAATCGACTGAGTGAAGCAGACTACCCCGACAAAGTATACTTGGATTACAGCGAAATGGCGGAGCCTATTGCAGTTCTTGAAAAGTTGAT
GGAGGTTCGGGGCCACACACACGAAACTAATGTGCCATTTGTTAACCATGTGCATTGCATTGTTTGATAGGACCTGGCCTTAAAGATCACAACTTTTGAA
GATCCACGCTCTTCTACGTGCACAGACGATGTTCTTCACGCACTTTCACAGCTAGCGCACCTGGAGACTCAAACGTTTGCTCTGTACTGGAAGTCAAGGG
CTCACATCAAC