Description :
From Genome Similarity Track
Location :
contig_36:194636- 196673
Transcript NameFunction/comments
g8769.t1hypothetical protein

Sequence
2037 bases(100 bases per row)
GAACAACCGAGTGTGACGAAGGAACTGGACAAGGTAACAGACCTTGCCCGGGAATCTCAATATTACGGCTCAATGGAGCATACCCAGTCCGAACTGGGGG
AGCAGCCAGTGTCGGAATTTGATCTCAAAGAAGAGCAAATACTGCCACACCGGAGGATAAGGGACCAGCAACCAACAGGTCAAGGTAGTTGAAACCATAC
TCCAGAGAAGAAAAATCGACAAAAAAAAATAGACCGAAGAAGGCCAAATCGACCCGCGGACTTGAGGAATTACTACCAGGAGGTCTCTAGGTCAGACAAG
GACAAGAAAGTCCGACAGCAATTCTAACAAGACGACGATGACAAAATCCGGCAGTGGAAGATAGTGGAAAGTGACGTGATGCTGAAGCCTTCACGATTCC
ACAATAACGATATAACTCACGGGTTCATCACTAACAATGTCAATGGATTTGGGGCGACGGAAAAAGACCGCCAACAGTGGTTTAGTGCATTCGGAGAATC
CGATGAACACGGACAAGGTGACGTGCGCATACAGAACGTATCAGATTGGAACGGGGAGTCACGACTCGCCTGCGCTGAGGGCACTATTGAACATGTGGAG
AATATTAGATCCAATTGCAGTGGCCCGACCATCACGATGGACTAAAGCAGCGCGGCAAGTAAAACTCCACCAGCGGTGTAGGGCATTGTAGCTCGGTGAA
TAGCTCCACAGGATTTCCGATATTCTAGCGAGGGCACGGGTGTGTGGTTTAGGCTTGACTGTACCATGCGTACCAGATAGACCCAGTCCTTGTAACTGAT
CTTGTAGGTTAAGATCATCGTCCTCATCACTTGGAGGATGACGCGGTTGAAACGCTCGATGGATCCATTCACCAATGTGCTGTACGCAGGAGTGAACGTT
TGCTGTGATCGCAGACGTCGGCTGAGCTCGGAGATGATTTCGTTCTTGAAGTGACTCCCGTTGTCTGAGACCCATACGGGCGGTATCTCGAATCTTGAAT
GCCATACCAGTAGGGCATCAATCACCACGAGGCTGTCTGCTGTGTCGGCCACTACTAGCTCGCAGTAACGAGTGGCATGGTCCTTCAACACGAGCAGGTA
CTTGCTGTTGCCGTAGCTCTCGCCCATGTACAAGTAGTCGAAGTGTAGGACACCATTACGCGTGCTGCACTCAATCACCTCACTCCACGGGCGGGGGACA
ACCTTCCCCCCTCACGAATGCAGACAGAGCAGACAGCCTTTGACGAAGCTGCCCACAACGTCCGCGATGTGGTTGATGGCGAAAAGTCGGCGTAAATGTG
CAATCATTGCGTGCTGGCCACGGCGACGTTGAGCACCACAATGGGCTACGATACAGAGGCGCAGTAGAAGGGAACCGGCCTCAGTTGGTATCCACAAGCG
GTTGTTGAGAACCACTAGACCATTCTCGTCCGTGTCTGCCCCAGCAGAGGTTGGGTGCGTTGATTGTACTTCTCGGAGCTCTCGAAGCGTAGGCCAGATG
AAATTGTCGTCGTCCAGCGGTCTCAAGGCTGAGACGGGCCTGGGTTCGGACGGTGAGAGGCTTCGAACCGCCTTCAACCGCTTCACCGAGACGGATGGCG
TATGGTTGCCGGTCCACCGGGAGATCATGTCGTCCCACACTTTGTCGGGTGCTCCACCACGTAGCGATAGTTTATTAATATCATCGCCCAACGTAACAGC
TTCCCTCTCACGTTCTTCTTCACCGACTTGTCCGGTGCGAAGACATGGATGAGGTTACGATGGTCACAATACATGCGGAAACGCTTGGGCTGTAGAAGTA
AGTAGTCCAGCTTGTCACACGCCACTGCAATGGGGAAAGCCTCCTTCTCGATGACAGTCCAATTCAGTTGGCTGCCAGTAAAGGTTCCGCTCATACAGAG
TATCAGGCGGTGCTGCTGTTCTTCTTCGAGTCGAAGTCGATCACTTGCGTGACGATGATTGCGTACCCGACGTCGGATACATCAGTGAACATACTGGTGT
AATGGGTCTGCTTAGACCCACTACTATAGCTTACACG