Description :
From Genome Similarity Track
Location :
Scaffold_19:1946040- 1950372
Transcript NameFunction/comments
Phyin_T30-4PITG_11229Aldehyde dehydrogenase
Phyin_T30-4PITG_11230Putative uncharacterized protein
Phyin_T30-4PITG_11231Putative uncharacterized protein
Phyin_T30-4PITG_11232Putative uncharacterized protein

Sequence
4332 bases(100 bases per row)
TCGTGTTTGGCGGGGAGAAGGACCGAGAAGATCAGTTTGTGGCCCCGACGCTGCTCAATTTCAAGAAGGATATGGACGCTTTTACCCGCAGTGCTGTGAT
GCAGGAAGAAGTGTTCAGTCCTCTGTTGCCTGTGGTCTACTACGACTCGTTGGATGAGGTTATTGACTTTGTCCGCGACCGTGAGAAGCCACTAGCGCTC
TACGTGTACACATCGAACTACAAGGTCCGCACACGTGTCTTGGATGCGACCAGTTCCGGTAGTGCGTGTGTGAACGACAGTATTGTGCAGTCGGTGAATC
TCAACTTGCCGTTTGGGGGCGTGGGGGCGTCGGGCATGGGCTCCTACCACGGCAAATACTCGTTCGACGCGTTCTCGCACCAGAAGAGCGTTCTGGTCCG
ATACGCCATGCTGGATGCGCCGCAGCGGTACATGCCGTACACCAACTCGGCACTGAATACCGTGATGCTGCTGATGAAACCTCTTCCGAACTCGCTCATT
GGTGTCGCGGCGTACGCCTTGATCTCCTTCTGCATTGCCATCGTGGGATTGATCTTGCAAATGTATCGGCATGGAGCAGAGATCGAGGAGTAATAAAAAA
GACTTATGAACGTGGCAGTCGAGCGAACAATTACGTAATTGGATTGGTGTTAGTCTTCATGGGGAATTAATTTTAGGCTGGTTACTTTTGTATTTTCAAC
TGCTCACTCTTCCTCTTCATCTTTTGGAATTAGAATCGTTTATTGATCTACTTTAAAAAGTACTACTACATGTAGTAGTAAATCATTCTTAGAGTAGACC
TTCTTAAAAGATACACGTGTGTATTTAAATCCTGTGTGGAAAAGTGACGGCTACATATGAAATGGCACACTGTACCAAGTTGAATCCATTTCGTGCGGTC
ATTGCTTGTATGAGTTCGTTGGTGCCGGATTTTCTTCAAGCGACGTTGGTAGTGCCGTGGTGGTGTACGAGGCTAATTGACGGAGATTGCCGAGCTTCAT
TCCGCTTTTTGCACGCATCAACACACAGCAACCTCACCTTCTTTGCCGACATCGAAACCAGTTGCAATGACCATTACCAAGGGAGTCACAAGCGTTTGAG
CGGGGCGCTACCAACACTCCGCAATTGATCCGCATGGATCAGCGTTTCTCCAGCTCTAGCAAAGATTTCAAGCAAAAAGCATCAACGATAGGATGGTGGA
CCACCCAAGAGCACGAGAAGTTCCTCGAGGCTATCGAGCCGGACCGTGGAAGAAGATCGCTCATCACATTGGCACCAGATCACCTCGTCAAGTGATGACG
CACGCGCAGAAATACCGACAGCGAATCAAGCGCCATCGAAAGTCGCGCACCGAAAGCAAAGCTGTGTCATCGACAGCGGGTGACAGTATTCTCGAGATGA
TGCCAGCCATCGACTCTCCGATTGCCGGACAAGAAGAAGAAACGTTGCTTGAAGTGCTGCAGTTGGAGCCACTTCCTCTTTTGCAACCATGTGAGAGCGA
GATATCCTGGCAGCCCAGCAAAGAGATGCTAGCCCTTGACGCCTTGCTGCTTGATGAGCTGGAGCAACTCATCGCTCCTGCTGAAAATATTTTGGTGGAG
CCAGCGAGCCTGAATGGTGACGCACTGATGGAGCTGGTTGTCGACACCTCAGTCGACTGGACTCCTGTGAACTGTATGCTGCTGTCTTAGTTGAGCAGCT
CTTTGATCAAGTGAGGATTCTAACAATGTTTTGGTCGTCCATTGAAATATATTTACTGGAAATTATTTTCGGATATACCACAAATATCATTTAACTCTTG
CTTAATTATGATTTTATTAATATCTAAATATAAAAATAACAGTTTGTGTTGGAAGCATAATGTATTACCGACTCTTCGTGAGCTTCAAACCTCCACCACG
ACGTAAGTTTTCCAGAGTAAAGACCATTCCTGACGCCCCTGTAGGTGTCTGGCCAGGTTGGCGCTAAAATTCCAGGCAGTTCCTGTGTAAAAGATCAATT
AGTTTTGTTAGTTTCTTGTGTCAATTATCTGTTTCAATTTAATAAGGTGGATATATTTATTATGAAGTTCATATTGTCTGGCCGTTTACAGCAAGTCGCA
TTGACTATTGATAGTATTTGGTACTGTGCCTTGTTGGTTTCCTTTGCTTCTAGCCATTGCCCAAATGAAGCTGAAGTTTCGGCCGCATCAAGCAGTAGCT
GCAACTTCTCGACGACGCATTGATCGCTCTACGCTTTTCCTGTGGATTTCGTGCTTGGTGGTGGCGCTGGATTTGTGTCTGACCAATGGAAAGAAGGTCG
CTTTTCCCTTGTTCCAGTTTCTTCAGACCTACCCAACTCGCTTCCTGGTATTCTACGAGCCCAAAGTGAAGACATTAACGGCTTTAGTGAACAATGCTAT
CGAGAAAATGGACATTTCAGACCAAGTGAGCGATGCGTGGGACTTCACCGTGGCTTTGGTCACGCTGGTATGCGTGCACCAGGTTATAGAGACGACGAGG
GTGTCCGTCGTAAGCCGCCTTAGAGCCCCGAGTGCCAAGCAACCTATGTAGAGTGAGCACTGTTCTCGCTTTTATCCACATACATACATGTGCAGTAGAC
GGGTGAATGTTTTGACTCGGTCACAGCAGTTGTGTTTTGATTCCTACGAGTCCTTTTTCCATTTTCAAGGTACTGCTGAATATCGCAAAGTTAAAGAAGG
TAGCTTTAGTGCGCTGGCAGACCCAGCAAGCGTATGACACAACAATACTCTAGTATTACACGTTTTTAGAGGCGCTCAACTGCAATGCTAGACGAGTTCG
AAGAGGCGATGGCTGCTGGAGGCTGTTCTTTTCCTGTGCCACGTTCAAGATGCAGTTAGCACTCTGAAAATGCATCCGAACTGTCAACACCCCGCTTAAT
ACCTCCTCGTTGAGCAATGCCTTGGCCTTGATCGGACTGTTCTCCATAGCAATGTCAATTTCAGTCTTTGGCCGCTTCATCGCCTTCTCCACCTAACACC
ACCAAAAACCAACCACCAAGTCAGCTCTTGTCCGTTTACAACAACAACAACGGCCCAAGCCGTACAATGTTAATCGTCTCGGTGGTTTGGTCCATGACTT
GTGACAGCTTCGCACTCGTAATAGCAATCGAAGACGTCGTCTACCGCAACCGCCACTTTATCATCAGCCAACCACCTTGCAACGTATGCGTCATTCAACC
AACAAACCTTCACGTAGGCTGCCTTCAGTGCCTCCACTTGCTCTTCCGTCAGTTCTGAGCCAAGGTCTCCCGTCAACTCCGGCTCCCTGCATCACCAACA
TCCAGCTCAGCTTCTCTGCTCCACCGTCCAAATATCCAATAAACCAAATTTCCAACGTACGCCACGAGCACATCTGCGTGGCGTTTGCGAGCTTTCTCCA
GTTCTCGACGGGCATCAGCCGCCGCCATCCTCGGTACCTGCAAGAAATCACCACATCAGCCTCCAAGGTCAAGATCGACCATCACTCTTTAGCATCGTAC
TCGTTCCCGGAGTTTCTTGACAGCAGCTTCCTTCTCCTTGAGCTTCGTTTCTAACTCTTTCAGCTTGGCGACTGTCTCCTCATCCACAGGCGCCACTTCC
TCTGTGGTTAGATACAACGTCAGCAACAGACATTCACTATTATATATACCATCACTCTTTCACACACGTTTGTCCTCTGGGTTGTATTTCCTCAGCGCTG
CTGCGAACACCGTCGCGCACAGGTCGTTCACATGCGCCTTGAAGATCTGCTGCTGGGCTGCGGATGCTGACCCGCATTCCTTCAGCGCCGCTGCGTTCAT
CTTCTCACCACATACGCGCTGCGCCTCCTTGATCTCCAAGAACGAGTAGCGCAGCGCCGGCTGCTCTTCAGCAGGCACAGGCTCTGTCACCGTCACCTCC
GTAGCTTCTCCCGCCATAACGAATACTTATTCAAATGTGAAAGCCGCACATCTGAAGTAGTCGTGATTGAAGTAGGACCACTTAACAAAGTTACTTTCCG
TCGTCACGTAAGTGAAGTGTGTGGCATCGCAGTGGATTGCCACGCCGCACTTGTCGCCGCTCCTGCTCTTCCTCGTGCGTCTAACTACGCGCGCAACAAC
TCGACGAACATGAGGCGCTCGGACGGCGACGACGTTGCCCCTATTACCTCTTCCTCCACGGCCGTGACAAGCGCTTCTGCTTTCGACACGCCACAAATGA
ACCCTTCCACGCCGCACCTACACGCGGCCAGCGGGTCCGCGCCCGGCAGCGGCGTGTTACTTCTGGGCAAACTCATGCGTCGCGACCGTCGCTTGTTCAC
GTGGAAATGGCGCGACTTCGTGTTGGAACGCA