Description :
From Genome Similarity Track
Location :
Scaffold_1505:1946- 3778
Sequence
1832 bases(100 bases per row)
GCTGCCGCTGCTTCTCGTCCCATATCGCAACAGCCTTCGGGCAGTCTGCCTGGAGCTGCTCAACGAGCTCCCACGAGTTATCCGACTCAGGGTAACCCCT
CCACTTCACGAGCAGCTGGCGCTTGCCATGGAGCCGCCGCTCCCGGACGACTCGTTCCACGTGGTAGTGGATCTGCCCATTACGATCAAGGAGGGCCGGC
GGTGGCCTCGCACGGCCATGGCTACGAGCCTGAGGCGACGCAGCCGTATGCTGGGGCCCCGAGTCAGGTGGTGGCCCTGCAGCAAGAGGAGATTCGTCTT
CTCCGGGACCGTGTGTACGTCCTCGAGATCGCGCTTGGCGTCGGCCTTGGTGGCGAGGCTGCCGCTCGTGCTGGTCAGCCTGGTGCCGTGGAGCGGCTCC
GTGAGGATGTTGCCTCGCTCTATCAAGAAACTCGCAGTCTCCATGGCCGTGTGGATCGTCGAGCCGACCTGTCGTCTTACGACTCGCTGCGAAACCAGCT
CGCTGGCCTTCGGGCCGAGCTTCATGGCCACGCGCCGTATCCGGAGCAGCAGCCCCACTCGTATCAGGCCCAGTTTGGCCAGGGCTCGTACGGGGCCCCT
GCGTATGCTGATCCGATGTACGCCGCGCCGTCTTACGACCAGCGCGCGTATCAGGCGCCTTACCGCGACCCGACGCCGCGCTTCGAGGAGCTGCGCTCTT
CTCCACCGGGCCACCCACCGCTTCCTGCGGGGCAGCCAGAGCCAGAGGGTCATGGTACCTCTTAAGACGACCCACGTAAAACGTCGGGTGAGTCGTCATC
GACTTGGGCAAGTCTATGGTGTACGCCGCGCCATGCTGGCTGAGGACCGTGAAGGGTCCAATGAAGCGGTGCTTCAGCTTGTTGCTCTCGACCGAGCTAA
CAGTGTTTAGCGGTAGGTTTCTAGTATCTAGGAGAACTAAATCCCCAACCTTAAACACGTTCATGTTTCCTCTTCCATTTCGGTCAGAGTACTCCTTCTG
TTTATCTTGGGCTTGCGCCATGGTGTCTCGCACCCTGCTGAGTATGTTCAGCCTGTCTTCGGCAAACGAGGACAGTTGCTTCCGCAAGGCGGCTGGACTC
ACGTCCGAGACTTGGGAGAAAAAGGTTTTCCGAGCCTCTCCCCCACTTAGGACCGAAGCCCCGGTACTGCCTCGTAATGTGAGCGGCACCTGAGGGTGGC
GCAACCCGTTCAGGTAAAAGGGCGTAAAGCCCGTCGATGCATGTACCGCATTGTTGAGTGCGAACTCAACCATGGGCAAGCGATCAGCCCAAGAGCGGGG
CATCTCCGCGCAGATACTGCGGAGCGTGTCCTCGAGCACGCGATTGACGCGCTCCGTCTGGCCATCCGTCTGCGGGTGGTCCGCCGTCGACATCGACAGC
CGTGTGCCGGGAAGGCGAAACAGCGTCTGCCAGAACGTAGCGGTGAACCGCGGGTCTCGATCAGAGACAATGGTCTCGGTCAGACCGTGCTGTCGGAAGA
CACAGTCCATGAACAGGCGAGCGACCTCGTCGCCAGTGACGGTGTCACAAACTGGAGCAAAGTGGACCATCTTGCTCAGACGGCACACGAAGGCAACAAC
ACCAGTGTTGCCACCGTCATCGGCCGGAAGTCCGAAGACGAAGTCGAGACTCATCGACTTCCAGCAGCCCGCTGGGACCGGCAGGCTCTGCAATGGTGCC
GAGGCGTGACCGGCAGGCTTCACGCGCTGGCACGTCTCGCACGTACGGACGTAGGTGGCGACCCACTTGTACATGTGACGCCACCAAAACATCTGCGAGA
CAGACGCGTACGTCTTCTCACGGCCGAGATGG