Description :
From Genome Similarity Track
Location :
Scaffold_2:1945528- 1947062
Sequence
1534 bases(100 bases per row)
TTCGGGCGCTGTTGTTAACAACAGCGCTCGTATTACTTTCCAGCGTGTAGCGCATGGTGGGCTTCGTACGCCCTCACCATGTCCGGGACGTCTTCGAGCA
AGACGTTCCGCGGCTCCCACGTATCTTGGTTGGGAGGGAATCCTCTCCAACGGATACGATAACGAACCGGTTGCCTGTTCGTTCTCGGGATACTGTTACC
AACAATCCGCTCAACTATCCATCGAGTTGAGCCGTGTGCGTCACGAATTGGCGGCGGTGGTGGTGGAAACACGCCCCGTGTGTGGTCAACTTGGTGTTGA
CCCTGATCTCGCGTCTCCCCACGATCAAGTCCCGGTCATGGCGTAGTTCCAGAGCGCTGCGTTCGGCGCTCTGAAGTATTCGCAGTTTGCGGGGGCCTCC
CAGACCGCCTCGATCGTTCCGGCCGAGCTGGACCATTAGCTCGACCCGCTGCTCCAGCGCGAAGTCGCGCTGAAAAGGACGATGGCTTCCGCCGAGTCTT
CTGCTTCGGTTCAGCCGAGCTAGGTAGCTCGTGCTGCAGGTATGGCTTCAGCCTTCCGACGTAGAACGTCGGATGGAGACGCATACTAGAGTGTGTAGGC
GTCGCCGTGCCTTGCCAGCACAGTTAACGGCCCGATAAAGAGCGGAGCAAGCTTGCTTGCCCCGAAGTCGGAATCGGCATGTTTAGGCAAGTTTTGAGTA
GCTAACAAGACTAATGAACCCTTCTCGAATACATTAGTGTTGCCCCTGCCAACATTGTCTGTGTTCAGCTTCTGTCGACCGACAGAAGCTGCCATAGCGT
CTTGGCCGAACCGAATGACGGCTTGTCTGCGCTGTACGAAGCGAATTGCGCCCGAACTGAACTCGTTCAGCTCGCTTCCAGCAGTAGGCCCGGCCTCTGA
GTTCGTCTTCGTGGTGTCTGTGCCCTGCACAGACACCTTCTTCGTCTTCTTCTTGCTCTTTTCGGCGTCTGTGCCCCGCACAGACACGTTCTTCTTCTTC
TTCTTGCGTGTAGTCGCTGCTGACACTGTGCAAGTGTCAGCGGCATTCTGCGGCTGCTGCGTTGCAGTCGTAGATCCTCCCCCACTCAAGGATGGAGCCA
TCATCCCGAGGAGACTCGGGAGGCGTGGGTGCCTGATGGCATTCACGTAGAGCGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCGAGCTC
CGCCATCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCTACAAGCACGCGGTTCACGCGCTCGGTCTGCCCGTCCGTC
TGCGGATGGTCCGCAGTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAACACTTCTTGCCAAAGGTGTGCCGTGAAGCGTGGGTCTCGATCCGACACAA
TGTCGATCGGCATGCCATGGTGTTTGCTTTGAACACCATGTCAACGAACAGGCGCGCCGTCTGTTTCACAGTCACTTCAGCGGGTACCGCAGCAAGATGT
ACCATCTTGCTGAAGCGGTCAACAAAGACCACAA