Description :
From Genome Similarity Track
Location :
Scaffold_16:194503- 196818
Sequence
2315 bases(100 bases per row)
TATCTACCTATAAATATACTCAGTTTACATTCTACCTTAATTAGGTCACTTCGCTCTCTTATAACTAAAGAGGTACCTGTGAACTGCCGTTCACTGAGAG
TTTGTATACTCTCGGAAGATAACTTCCTCAAGCGCAAGGTGCTGTGTGACCCGGTCACACTTGGTAGCACTTGTAGTCAATCCACCCCACCACGGGTAGA
CTACCTGAACCTCTCCGAAGTTCGTTGTTATGGATAGGAACGACTTCTCCCATATGAACGACCCACAGTTCGAGTCGGTTCGGAAGATGGCAGGTATCTT
CGGGATGGAGGCCTGCAGAGCCTGGTGGTGTCAACACCGGCCGAACAGCTCAAGCGCGCCAATGCGTTCGACGCGTACGAGCAGTTCCTCATCGCGCATG
TGCGAGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGCCGTATGAAGGGAAGGAAGGCGAAAACCTTCACTG
CTGGGTCCGAGAAGCTGGGCTCGCGATGGACGCGGCTCTGATATCGACCGAGCCGCTTCGTGCTGCTTTTGCACTCTCCAACCTTAGCGGCTGTGCTAAG
CGTTGGGTGTACACACGGGAAGCAAAATCCCCTGGATATTTCACATCTTGGGCGCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACG
AGTACCGCCAGCGTTCGCGTTTCCTCTCGTGTAAACAAGGGAGGCGTGAACTGCACGAGTAGGTGCAAGATATACGGGAGCTCACGGCGTCCCTAGTGGG
AAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACCCTTG
AAGAGGCAATTCAAGGGGCTCTTCAAGAAGCGTACAGCCATCGCCAGGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTCCCGGAT
GAGGGAGCACCAACGGACCAGTTCTCATGGAACTCGGGTCCGCCGAACAGCGTGACATCTGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCGA
CTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGGAAAC
CAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCAC
TCTCGAATCGGCGAAAAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGATTCTGGGGCGTCG
AAGAATTTCGCACGCCGCCAGACGGTTGCTCGCAACAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCAACTGA
CCGATGGGAAGGTCGTCACTGTTTTCAACGTGCAAGTGGATCTGGCCGTCAAGTTTAAAAACTTTGACAGCCTCGAACAGTTCACATTTCTCGACATGGA
TCCCTACGATATGATCCTGGGTATGCCCTGACTCGAGAAGCACGAGCCCTGAATCGACTGGCGAGGCAAGCCAATTGGTGCCAGCCGCCCTGCGAAGTCC
GACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCTGGGGCGCCCGCAAGGGTTCCCAGGGTACCACAGCATCCGGCAGATGCTTGGGAGTCG
TCAACGTATATGACGACTCCGATGATGCTTTGATTGGTGGCAGCACCCAGAAGAGGCGTTGGCCAAGTGGGTAACTTAGGTCCACAGGCGAATAACGTAG
TTCCGCAGACAGCTGCAGATGTCATGAACACCGAGAACAGCGTATTCAGAGTGGGTAACAGAGTTCTACACACGGTCGACCAGACCTTAACTGAAGAGGA
AGACGTCGGACACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGCGGAAGGCGTTGAACACGCTTTCTGTGTGGGT
AACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGAACACGCTTCCTGTGTGGGTACCACAGTACCCCACGAGGCCTTAAGTG
CCTCGGATGTCGGTGCTTCTACATCCCCAGACGTGGGTAACAAAGTTCCACGCCACGGTCGCCGTCGACGACGCCGCCGCCGCCGAGAATCGACGTCGCT
TCAAGCGACTCGGAG