Description :
From Genome Similarity Track
Location :
Scaffold_878:1945- 9432
Sequence
7487 bases(100 bases per row)
GCTCGGAATGGCAGCTCAGGAAACAGGACAGTGATCTTCATTGTGACAATGGCGACCCGGTTTAGTTTCTTGGCGGACCAAGGCTCAATGTCTCTGGTGG
CGAAGGCCACAGGAGCACGCCGACCAGGAATGAAGGCAGCATCCGGACCAAACGGGGCCACGAGGAGCATCCCTGGCAATGACGAGTTAGGAGGAGCAGG
GATCAAGACAGATCCAGGGGATCCACCACCATGAGGTGATCCCCCTCCACCATCACTGTCGAGCTGGATCGCAGATCCCGCAATGCCGGCTCCGGATCCG
GATGTACCAGTGCCTTACGGGGGCGGTGTCGAGAGGGATCGCCGCCGGGCTTCGGATCTGGACTGGGACAAGGTCCGCCGCGTGTCTTCCTCCAAGGCAT
CATCAGCGACTCGAGCCTCCTCCGAATCCTCCGGACTTACATCGTCATCGTCGTCGTCATCGTCATCATCATCATCGTCCGGGGTGAAGGAATAAGGGCC
GGAGGACAGCGTACGCTTCGACGACGATCGGATAGGAGGCCCCGAGCCGTCGGACCAGTCCGATCCCTCATCCTCGTCATCCTCCGAGCTGCCAAGTCCA
CAACCAGTGGGAATGACACGTTTGGCTTTCCCTTTCCCGGACCCAGTTCTGGCCGGCGGAGGGCCGGTAGAAGCTGGCTGGGGAATGGCAGGCATCGTCA
CCGAAGGGCCAGCAGTGGATCCCGACTGTGACGAGCCGGACTGGGCCGTGGACACGACTAACCCCGTCGTAGAAGGGGTAACCACCGCAGATCCGGCCGA
AACCACAGCCTGGGATGACGGCGCGGTGGTGGATCCAGTCTTGGACGTAGATCCCGTCTTAGGCGAAACGGCGGATCCGGTCTTAGACGTCTTGGATCCA
GTCTTGGACGTTGATCCCGATTTTGAAACCGCGACGGATCCAGTTTTGGACACCTTGGATCCGGTCTTGGATGCCGATCCCGACTTGGATGCCGCGGATC
CAGCCTTGGCAGACGATCCGGACTTGGATGGTGTGGATCCCGGTTGAGGTGCAACAGCGGATCCAGTCTTGGGCCCAGACCCATGTTGACGTGACAGCAG
TGGATCCAGCCTTGGATCCCGTACCCGTCTTGGACGTAGCTACGGATCCGGCTTTGGATGTGGCAACGGACCCAGACTTGGATCCGGCACCGGACTTCGA
GGGGGAGGCGGAAGGCTTGGACATGGATGTGGATCCAGGCTTGGACGTGGATGTGGATCCCGCCTGAGAGGCTGCCTTGGAGGCCGAACTGGCTTTGGGC
TTGGCCTTGGGGTAGACTCGAGCATGCTTGTGAGGACGGGGGGGGGGGTCCAGTGCTAGGAGCGGGAGATGCACTACGCGGTCGTTTCGCAGCCGACTGA
CCCGCTCCACTTACAGACGGTAGAGAAGCAGAAAAGCTGGCAGCAGGAGGGGGCCCAGACAGTGGAGGAAGGGGATCCGAGATAGCAGCTGTCATCAGCG
CCAGTCGTCGGCGCGCCAAATCCCGCTCCGATAAGCCGCGATCGCGCTGCAGAACTAGCTGCTGGTGCTGAACGTGAGCAGCAGCGAGTTGATCCCGGAG
TTTTGCTGCAGTTGCCTCGGCATCCTTTAATTTGTCACCTGGATTGACATCACAAGTGAATATGGGGTTACTAGCAGGGGACAAAAGAAGATCCACGTAC
TCGTGCGGCGGAGCTTGGATTCCAGCTCCGTTTGCGTTCGCTTGGCATCCGCCCACTCGGTAGCCGCCTTGTCCCGCTGGGGTTCGGTGTCCGCCAACTT
CGCTTGGATCTCGTCGCGCAATTGAGTCACGCGTACGAATTCCTCGAGCGCGTAATCTCGCCCAGCAGACGCTTTCTCAAGTGACTCCTTGGTATCTTTC
AGCTCCTCAGAGAGACGAGCCAGAGCTGCATCCGGCGACGAGGGAGGTGGATTTGGCGCGGGGGGCCCTCCACGCGCCGACCCTAATGCGGACCCGCCAT
GGGTGGATCCCACATAGTCGTTAGTTACCATCTCTTCTTGGGTCAGGCGCAACTCGTCACGGAGTCGATCCAAGCTCTCGTCCGCGGCTGCACTAGCAGT
CTGGGAATCCTCCAGATCCCGCTCGAGGTCATGGATCCGGGATTGGAGCTGGTGGATCTCAGATCCAGCGAGCGCCATCTCCCCAAGGAGGTGGTCGTTG
TCGTCCCGCATGCCATCTCGCTGACGGGAGGCGCGATTCAGCCGTCCGGTCAAGTCGCGGATCTCGACCGCTTGATTAGCCAACAGGAGTCGCAGGTCTT
GCGAGCGAGAGGCCGCACGGTTATCCCACCCCTGGATCACCATAGCCTGGTCATGGTCCTGGGCGCGCAAGGTTTGGAGTTGGGTGGCGTGCAAAGACGC
AGCTTGGTCTCGGGCATCGTGGGCCGTCTGGAGCTTCGCCGTCAAGGTTTGCACCCGATCGGAAAGAGCCTGGGCTAGAGCCCGCAGATCGGTGAATGAC
ATTGAAGAAGGGCTGACCGGAGGAGTGGTGGATGGGGCCTTGCCCGGCGATTTGCTGGTACGCTAGGTGGGAGACATGTGTCACGAAGAGGAGGAAGCGG
TTCTGGATGCTGGTAGTGCACGCCGTGAACGCTGTTGTGCAGCGCCAACAACGTACGGAGGCGATTGTGGTGAAGTGCTTTCTCAGAAATAAGAGAATGG
ACCTAACGCGGGGTCACTATCCCGAATCAGTGACAATTCTAAGTCGGTCACGCGTACCGTCGACATACGCACGGTGCTCTTCAAGCAGCCGGGCGCGTTC
TGCGCCTTCCTTCCCCTCGAGACGACGCAGGAACACCTCCGCTTTAGCGCGCGTGACGCGGCGGGGAGGCATCTTGGTCCCGCGTTTCGTTTTGGAGAAT
GAATGGATGGCTCAGAGGCCTCTCGTTTGAAGCACTGTCTTACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN