Description :
From Genome Similarity Track
Location :
Scaffold_630:19448- 24392
Transcript NameFunction/comments
Phypl_g9932DNA mismatch repair protein Msh2, putative
Phypl_g9933conserved hypothetical protein
Phypl_g9934hypothetical protein PHYSODRAFT_309966

Sequence
4944 bases(100 bases per row)
CGAAgccctccagctcgtggctcTTCTGCCGAGCGCACTCAATCACTGATGCAGGGAAACCTGCCATGGAGGCCACGTGGACACCAAAACTCTCCATGCA
TGGGCCGTCGCGCACCTGGTATACCATCGTAATTTCCCggtcgctggccacggccgtGACGTGCTTGTTGGCAAAGCCGTGAGGGTGTTCCTGTTTCAAC
GCTGTCAGCTCGTGGAAATGCGTCGCAAAGAGACACATCGAGCGCGCCTTGGTGAGGAGATATTCAGAGATTGCCCAGGCCAATCCAAAGCCATCGTACG
TGGAGGTGCCTCGACCCAGCTCATCAATAATCACAAGTGAGCGCTCCGTGGCCTTGTGCAGAATGGCCGATGCCTCTAGCATCTCAAGCATAAATGTCGA
AACACCCCTCTGCTGCAGGTCACCCGCACCAACGCGAACCAGCAACTGGTCAAACACAGGCAACCGTGCTACTTCAGCCGGCACAAAGCTGCCGATTTGC
GCCATCACTGCAATGGTGCCCAATTGGCGAATGTAGGTGCTCTTACCACCCATGTTTGGCCCGGTCACGAGTTGGAAACGTGATTTCTCGCGCTTGAAGT
TGTAGTCATTCGGGATGAAGTCCACACCGTCCTGTAGTTCCACACATGGGTGGCGCGCGCTGGTGAGTATGACGCAGTCCCCGTCTTGCTCTAGCGTAGG
GCGGCAGTAGCCTGAGCCAGCGTGGCATGCAGCGTGCGCAAAtccaagcagcacgtccaaTTCCGCCAGTGTAGCAGttgcagcttcgagcacaGGCACA
TACGTGCTGGCCACATCGATCGCCGCACTAAGTAAATGAGCTTGTCGCTCTTCATATTCACCGCGCAAACGACGGTAATCTGTGGCAAGCGCCTTCAACT
TTGTCGTCGTGAATTGGACTCCGCTCACGAGAACCTGGCAGATGTGCACGTACGGCAGCTTGGACAACCgtgcctcctccttcttgtttACAACACGGAA
AGCAAAACCGCGAaccttgtccttctcgcACTTGATATCGCCGCCAATCGTATCAAGAGCATTGCGGTGTTCCTCCTCAATGTCCGCAAGGATGCCGTCC
CACTCCTCACGCAGCGCCTGGAGATTCTCGTCGTGCTTAGCGTTCACAACTAGAGTCGGGCGACTGTCGAGGTCTACAACCTCCTTCACGAGCTCTGTGT
ACCCTTGCAGGTCTGCAagcaccttctccaacgGAGCGGCAAACTTCTCCTTCACAAGTTTtgcaagcgcttcatctccaccTGCCTCCGTAGCCTTCAA
GAGGTTCAGAATTCTTGGCACAGCACCAACCGCTGCATCATATACACTCACAAGATCCGTAATTTTCGCATGTTTCTTCCTTTCCAGACTGATCGCCAGT
CGCCCCAAGTCGGGCAGCGCCTTCAtgcactcgtccagcagctccatcctcAAGGACGAGTCGTCCACAAAGAGCTGCACAAGACTCTGTCTGGTCTCGA
TCTGCTTgacatccagcagcggctgtCGGATCCATCTCTCCAGCAGACGTCGACCCATAGGCGTCTTGCCTCGGTTCAAAATCTCCAATACACTGCCTCC
AAATCTCGCCACTCCGgtcgccgtggcgctcggcTCCGGGAGCAAGTTGAGCGACCAGACAGCAGCGCTGTCCAGCTGCATGGCCGACGAGAGGTTGCCC
TCTTGCAGTGTGTAGCAGCcgaagccgtcggcgtcggccatggcgcccagcgcgtcgatcAAGCCGGCCAGCGAACCCGCCGCGATCTTGGaggccagca
cgtcctggtactcggccatggtgctggcccCCAGCAACCTAGCCACGTTGGTTTCGACTGCGCTGATGTCGTGGAaccgctgcttcttcacgtacacggc
ggccacctcgtgggtctgcagcagcgcgtgcagcttcttgctgtcgcCCACGGCCTGcgactgctccagctccgccgaTAGGTAGCACGTGGATGgcgcc
agctgcaccagcagagACTCGAAGTTGGTCAGCTCGCTCGAGtccgagaaggagaagagcagcagctcccactGCTTGGTGTCCTCGTCCGCTTGACCCT
TGACGCACGACGCACGCGCGCGAGGCCGGCGCACCGCCACACCCACTTGCTTCAGGTGCTTCTCGTTgcggatctgcagcgccactTCGGCCTGCGCtcc
ctccagcgtctcccCGGTGGtggagtcgtcgtcctcacGCTCCCAGTCGACCATGATGGTGTAcgcgtgctgcagtgcgGAAGAAGATTCAAGAGTGAAT
GTCTTTTGGCGCGCTAAATGCGGACTTCCCGCGTTTTTGTCTGTCCGGATGAAAGAGCCCCGTAGCTGACTTTGCATAGCGAAAGGAGTGATGTGAGACC
CTTCTTGTCGGACAATTTCGAATTTACCGATGGACTGGCGCGCGGAGTTtgtgaaggcggcggcgctggaggagaacggAGAGGGGCCCACGTCGACTTC
GACCACGCAGCAGAGGACCAAGGCGCCGGCGGATAAAGTGCTGGCGTttctggatctgctgctggtccacgaaggcggcgagTGGTGGTCCAAACTGTGC
CATCGAGTTAAGCGGGATGCCAAgaagagtgatggtcagGTGGCCACGACGCTGAACGAAGAGGACAAGAGGCAGatcaagacgctcaagagccggctgg
cggcggtgggtGATGTGCTGTTCATCAAGCTACCGGAGCTGAACgcgtccgtgagcagcaagaagaccccgcgcgccgccaaagtgcgcgtgctgcagct
gcagctcctgtgCCGTATGCTGCGCTATGGAgtgctgaccaagaagaagaaagaggagaggaagcagctgaagaaggagatccgagggctgctggaccgc
gtgGCTCTACTGCTGGATGCGGCCAACCCGCCGTCGTTggcggacgaagacgcggACGAACGCTCGCCCTTCCaggagttcctgcagcaggagttGGCGC
CGAgactgcaggtgctgctgtcggagtTGATTCGGTACTTGCTGAGGGCGTATGAGCTGAtagaggaggaagaggccaagGGTGACGAGGAAAAGGATGC
GATCAACGCGTTGCTGCCTACGGTGAGCGGCTGTGCTGCCTTTTGTAGTTGATGCTGTTTAACTGACGCTGCTTGTtcggtcgtgctgctttgCAGTTGC
AACCGATGGTGAAGCCACCTCAACCCCCTGCCGAACTTCCGAAGGCTGCTGTTACAGGCAAGGGGAGCATCTTGTCTGCTTTGCGCCAAGAACGGCCGGC
AAAGCGCGCTCGCCCCGACGCAAGCGGGTTGTTCAAGGAAGTCCAACTCCCTCATATGCAGTCGCGACCTCGAAAGTCAAGGCGGGTCTCCAaaagccac
agcagcagcacaagcaacAGTGTTAACAACCGTAGCACCGCGGGATGCAGCCAagactcgctgctgcgcgcggcaAAGTCGGCGCACAAGCCGAGGACTC
TAGACTTTGCAGGCACAGCAAAGACTAGCTTAGCGCCGAGCGTTCGAAAGCCTGGTGAGACCGACTTGctgcgacgcgctgctgtgtcgtccagcatgaA
AGGACCGACAGCATCTCAGCTTCACAGAGCAATTTCGGAGCGCTCTCATTTTGCTGGACGGCAACCCGTAGCCTCCTCAGCACCAGGTGCTGTCGCACAA
ATTGGAGGAGCAACACGCAAAAATCAGTCGCCGCAATTGCGCCGAGCGGCAACTACTTCATCTGTGGTCATGCGTACGCCCGATAGACCGAAGCGGATGG
CAGCACGAACTACCAGGAGGGTCTTGGTAGAAGCATCCCCCCCACTCCGCAGGCCGAACGGAAccggagctgctcctcggctTCTTCAGCCCAAGTCGTC
ACGCCCAGGCACCAACCCTCCTCCGCTGTTTCGTTGATGCTGCTAGACTGTCTAGCACAAGTAAAGTAATATACAGTGGAGGCATCTGATTAAGTCTGCA
TCGCTAGCTCGTCTCAGCGTCATCGCTGCTACTGTCACTGCCGTACGCCACGAGTCCAAGCGCTGCCGTATTGGGCTTATCCTTCTTagccaccagcaac
ttgCTATTTTCACccaccttctgcttcttcttcagcggcaCCTCTTCTGCCTTATCAGAAGACTCCGCTGTCTTCGAACCACCCTTGCGCGACGTATCTT
TTCCAGCCTTCcgcttcgccttcaccacTACCACCACAGTCTTCTTCGAACTCGCAGTCTTCAGGTCGTTCTTGGCAGGATACTTCTGCAAATGCTGAGC
TGTCAGTGacgcgccagcagcagctttaGGAGCGCCACGTGCCACCACTAAATAAACAGCCACATCCAGCACGGTTAGCTCTGAATGAACACCAGCACGG
TGTACCCCGCTTGGTCGTCCTTACAGAATTGAGCGAGGtcttcctcgtgctgcgctTGACGCTTCCGCTCTGCGTTCTCCATCTTGCTCTCGAGGTCCTG
AATGTACTCGAACTCCTCCTCATCGAGACCCTTGGGAGGAGCTGAAACAATTGCACCAACATCACCAGTCACAGAGCAGAGGACGACTAGTGTTAGCCCT
GTCCATCCGTGACTTTCATCCCTCCAGTGCTACAACCACAGCTCGAGCTACGCACCGAAGGGGttgttcttctccttccACTCGCTGTCCTTTAACTCAT
TACGCTCCTGAAGCTGCTCATACAGCGGCTTGTAGCCGGATGCGTCCTCTGGTCGCGGGGCCGGCGCCTCCGtcacgcgcttctcctccacgttgtcgcc
gaagagctgcagacgcggACATTGGACGGAAACTGTAGCGTTAGTGGGGTGAGTTTTAAGCGTGGAACAGTGAGTGCAGAGTTCAGCGACAAACCCCATC
GGAAGATGTGAGAACGGACGTCGACACGAAGCCTGCCAGAGACG