Description :
From Genome Similarity Track
Location :
Scaffold_6:194477- 204490
Transcript NameFunction/comments
Phyta_totarag487hypothetical protein
Phyta_totarag488hypothetical protein PHYSODRAFT_552331

Sequence
10013 bases(100 bases per row)
CGAGCTTTGGACGTGATGCCGCCCCTTCCCAACAAggactaccggtacatgcGTCAATACCACGCCGTCGATCCTTTGCCTCCCCCTATTTGCGCAATGT
TGGACGTCTGAAACCCTGCAAGTCGAGTCCTCACTAAAAATATATGACATCACATTGCAACCGCCGGCACTTTCCAAGCGGTGACGGCACTTGGCTGCTC
CTCTCTGTGGcaatgaagcagcagcagtatggCCAGATTCAGATCTTGCGCGATAGCGCACCAGTCGTGGACTTGGAAAGAGAACCGCGCACGAGTCGGT
CGTGGGCGTGGGTCTGCTCGGCGCTCGTAAGCCGAGACAAAGGCGAATGTTGTGTGCAAGTGGTGGAGAGCGTGTTCgtggacaagcagcagatctgCTC
TTGGTACTTTTCGGACGGGGGAGTCGTGCGCCGTAAGCTGCAGAGTAGACTCACACCGGAGCAAGTGCATCGTGCATTCGTCCAGTTTGGTGCTGAATTT
GGCGGTGATAATGCCGCTTTCGATCCCGCAACGAAACCTATTGCCGTGTGTTGGTTCGAGAAGAATGACACACCGGGTGCGGTGCCGTTCCTAACTGCGT
CGGATCTCTTGGCGTTTTTGAACTCGCTTCCATCTAGCAGCGGGTGTAGCGCTACCGTCAGTACTTTCGTTCATCCACGAGGTGAGCTCGACCCCGTTTG
CTATGCCAACCTTGAGCACGAGTTCACGTACGTGCTTCGTTTTCTGTTGTCACTGAAGCTATGATACTCGATTTTGATGCGTTAATTACTGCTTTGTGTT
GTGTTTGCACAGTCTTCAGAAGAGCGGCCGGGTGCAGGGCAAACTGTTTTGGTTGGCACTCGGTGGTCAGAGGATTGCTAGCAAGGACGTAAAACTCAAT
ACGACAGCGAACGAATTCGTTCAGCAATATGTAGGTTTTCTGGAAATGAACAAGAAGTGCCGTGTGGTACGCTGTGTATCGCTCTTCATCATGGAAGACA
GCGGAAGACTACAATTGTGGCGGACATCTGCATGTGAAACTATTTCTGCTGCGGTAGTGCTGCCATTAGCTCCTACTTTTCCAGATGCATTGACATCAAA
TTCGTACGAGGGACCTCGCGCCATGAACGCGAGATTAATAGCTCGAGCTCGGGCTGAAGGTTCGCGGGCACCCGATGAGCGGTTAGTTGAAGCGATCATG
GCAGCTCCAACTGCGTATTCCAACAGAAATTcgactcgtcttcgtccagcttcaccttcGAGTGCCGCAACTCGCTTGGACCCACTCGGAGACTTGGAAG
GCAGACGTCGTGCGAACCTCGAGCTGCGTAATTCGAGCGATTGGGATGAGGCTTTGTCGTTTCTGCCGGCTACATCTTCGCTGTctcgaggacggcgacg
caCCCTGTCAGCAGCTCACCTCATGTCCAGCCAAAagcgtggctgctgcggagACTTCTGTAGCTTGTCAATTGCCGAGTTGACTGCTCGAAGAatggag
cgcaagaaggagtCATCGCTACGCGAGCAGGCAGGTCATGCTCGAAAAGGCCGGCGACGGACAAGTGTCTCCACTGCCGCAATTACTGCAAGTGCCTTCA
TGGAAGCCCATCGTACAGACGACTTGCTGGGTCGGTTAGCAGAACAGCGAAAATCATCGTCGCCTCAGCGATTGCAACGTGCCGAGACCTTGCAACCTCA
GCCACTTACGCATACTATTCCGTTCAAGCTGGTAGCACAGACCCGAGCCGAAAAGCAGCTTGTGGATCTCTTTATTCGACGATATCAAAATGGCGAGGAG
GGTGACTACCTCGCAGAAGCCTATTACGGAGATGGCGAGCCGCTCGGAGTCACGTTTCCAGGATACTACTACCGAGACGTACAGGTTTGCGCCAACTGCT
ACGAGTTTTACATGCTCGTTGAAAAAGTCCGCATGAAAGCTCTGAATCAAATCGCGCGACACGAGAAAACGAGTCCAAATCGCCGAAGTTCAGGCAAGAA
AGAGGGAAATGAGCCCGCTTCACGTCGTAAGCGGGTTCAGCAACTCGCAATTGCCGAAAGAGAAGAGGgagaagaggacgaggccgaAGAGGACAATAAT
GACAACGAGGTGTCAGAAATTCGGGATAGTTTACAGCATGTGTGGAAGCATGTATGGGGACAAACTTCCAGTGTGGCCGAAGCCATCACCAAGAAGGATG
CCGCCGAGCTGTACAGCTTTGTAAACCCTCATCCCGCAGTGGCAATGGTGTTGAGTGCGCTTGGGGCTTTGCTGTTGGGGTCACGAGGTGGGGACTGGAG
TGAAGTTAAGCGAGCAATTTCGCAAGACAAGCTTCTGTCGCGGTTGCACCGGGTAGACCTGGAGGCACTTTCAGAGCGTGCTGTGatgcaggcagcagct
cacaCTCGGAATCCGCTCTTCACACCGGTACAGATCGCGCCGATTAGTTCATGTGCCGCACGGTTCTGCGATTGGATCCGGACTGTGCTGCAGGCTTACG
CGTGGAAGCAGAGACTGCAAATTCAAGACTCGGAGACACGACGAATGCTTTGCTTCCTTAAGCCGGAGATTCTACCACCCGGTGTTGATGCTTCTCAACT
AGAAATATCccaacgtgaagaagcaacgGTGAAGAAGGTCAAGACAGACGATGGCCCGCTATCCAAACCGCGACGTCAGACGCAACAGAAGCAAGTTGCT
CGACAAGCCATCCAAGCGCAGCAAATGGCACGCCTTGCAGCACCATCAGGGATTCAAGGTGGTGTAACTGGAACCACTGCAGACAATGTATTCACCTGTC
AAGATGGAGTCACGCAGATACCGTACGCTGTAATTGGCCAGCCCATCGGCGAGACCGTCAAGTGTAACCTCGTCGTTTTTCACGACCTGTTCGACACGCT
CGAAAGCACTCAAGTGTTCTTCCGGTCTATAGTTGCGCGGAATGTGGGCGCacgagtgctgctgtttaATTTCCCGGGCCAGGCTCGTTCTGCCTATGCC
GTCGATGATCAAGctcgtgaagaagacaaacTTGTGCTGAACAACATGTGGCTtgctcgtcgagttcatgaaTTAGTCAACTTCGTGCAGCACACAACCC
AGTTCGTGACCACAGGTGCTCCTTTCCATATCGTCGGCTTCGGCAATGGAGCGAACGTGGCCACGTGCTATACTGTGCTATACGGCAAAAGCTACGACGA
ATACTTGCAGTCGCTAGCGCTTTTCAATGGGTTCGCGAGCGTGGACGCACAGCTCGCAGCGGTGCTTCATAGCGCAGTGAACGTGTTCGCATGTCTGCCA
CCAACGCGACCAGATCTACCAGTGTCTTTCTTCTGCAAGTTCCTCTTTTCTGAGGCGTACCTGCGCAAGGTCGACATGAACTTAGCACTCAGCATTTACA
CAGCTGTAACCAACGCCATTACGCTTGACGGGCGCATTCGCTTATGTCGTGGTGCACTCCGTCATGTGGATTTGGGCTCTCAACTTGCAGAGATCGACGT
GCCGCTTGTCCTTGTACAGTCTGTAGAGAACACCCTTGTAGCCCCCACCAATGTGGACCCATTCCTTCAAGGCCGTGCCAACGTACAGCATGTGTGGTCC
CACCAACAACCACATACGAGTGATCTGCGTTCCAAGACTCGTGCACAATTGAGGAAAGCTCTAGCAACGCCGAAGAGCGCCTTTGTATCATGGCTCCGTG
CTGGACATGAACTCCGCCAGGAAGCGAAAAACTACGTTACCGAGGTGATTGAGATGCTGGTGAACTGTCAAACGGAGCCATCAGATAAAGAGCTGGTACC
AACAGAGGAAGCCGGTGAGCACCAAATAGCAGCTACaaaggagcagcagaagacaaCGACAAGGAAGGAGTCAGCAGTTCGACAAAACCTCGAAAGCCAA
ACTGTCCAACCACTGGCGAGTGCTCTTGAATCCCAAGTTGCTACACCAACTTCAGATGCCCCATTGACACAGCATTTAGTTGCAGAACCGCCAACAGCAA
ATCGGTCGTTCCAGCAAACCAGTAAGTCTCCGTACGAACTTCAGCTAGAAAAGTCCGAACGCGCTTTCCAGGAGGCTTTGCGAACACATGAGATCCAAAA
GACTGCgtacgagaagaagaaatggcAACAACAAGAGCAGCTTTCCAGTAAGGCTGCAGTTGAGACTACGCCCACGATGGCAACTCCGACAAAGGAGACT
GCAAAGATCCCGATAACTCAATCCGTTGTCCCCATGGACATGCTGCTACCCcctgctcttccagctcctgtaCTGCATCCACAGCAGATATCAAacgtcg
atgaagaagctcaaacACCGCAACATCACCAGCGTAATAATGAGTCTAACGCTACTCAGATGGACGATGACATTGAGAGCGTACGAACCAAAATTTGtgc
cgaagaagaacgtcTTGAGAAAGAAGCACAAAAACAACGTCAAAAACACCGAGCTGCAACTGAGGAGCGCTTGGCTGCTCTACGAGAGGAACAGGAGCGG
AGACGGCGACAATGGGAACAGGAGGATCGCGAGCGACTAGCAGCTCTTGAAGCACAATTGCAAGCCCAGCAGGCCGAGCGGCTCGCAGCATTCCAACAGA
GAGATCTGGAGCAACTCGCGAAGGATGAGGCAGTGCTTGCTGCCGACAGCACTGCATCTGAAACACCTTCATCTACTCGATTGCTGGCACTGGAACCGTC
CGTTGAAATGCCCACTCCTTCGATCCAGTCCCCGAGTGCGTTGTTGTCTCCGTCCGTGGAGACCACACGACAGCAAATTCGAGATCGACCAGAGCTTCCT
AGCATGTTTGACCAGCTCGAAGCAGAGGAGCAAACTCGCAAACAGCGAGAGAAAAAACAACGAGCTTTCGGGCCTGGGCTAGCGGCTGGAAGTCACTTGA
CTGGTGAGCAGTACGACGAGGTGCGTTCTTCATTACAGCAAAATTTCCGCGAAGATACACGGGCAAACGAGTCCAACATGAAGCGTGAATTGCGACGAAG
GCGTGGCGCTCAAGCCACGCGAGTGCAGAAGTATATCCGTCGGTTCTTGGCCACGCGTCGAGTTGGTCGTATACGACTTGAAATGCAGCAGGAACGCGTG
AAAAACTTCGCTGGTGGCGAAATCGTGCGGATAGCACGGGGCCGGCTAGGTCGTCGAAGATTCCGCCGGTTGTgtgaagagaaggaagaggcTGCAAGGC
GATTGCACGCAGCAATGCTCATCCAGACCATTTACCGGGGCTTTTCGAGTCGCGTGGCCTACCGCGCAAAACTACGAGAAAGCAAGGCACGGATGCTGGA
GCGGGTATATCGTGGTCATCTTGGTCGCAACCGTGCTCGAAAACTACGCGAGGATCAAGAACGTCGCTGCTTTCAGGACCGAAACGCTGCGAAGCTGCAA
GCAACTTGGCGCATGTACATCGCTCGTGGACAATTCCTCACTGCTCGGTTCTCCGAGCTGGCAGCACTGGAGATCCAGCGGATGTATCGTGGTCTCTTGG
GGCGACGAGAGGCTGCACGCAAGAAACAATGGCGTGATGCACCGCCTGGAGCTGAAAGACTAGCACTTGGACTACAATTGATTGAAGGCTCGAAGCAGGC
ATTTGAACGTCAGcagaacgagctggacgcACTGCACCGCGCACAAGAGGCTGCCGAGCGCCAAGTGAGTACTGTCCACAACGAGCTGCGTGAAGCTGAG
AAAGAACTGGCtgtgctggagcgcgagctgcaggaaaTCGATCAGCTGGATGCCGACGTGCGTGAACTGACCCACGAAGCCGAGCGACTGCATGCTGGTG
GAGTCGAGGGTTTGCTACGCAATCACCGCTCAGCATCTCAGCATCAACCTCTAGGCAACGGAATACCCCACGCTTCCTCCTCACCGGACAGCAACGATGG
CGTACCATATGAATTTGGAGCGGAAAACGCGCTGGAATCGAAAGAGGCTATCAAGAAGCGCCAGGCCGATGCTTATgcggtggagatggcgctcagcatc
aagcgtagcgagcgcgagaagaaAAAGCGTGACCTGGAGGCCGAATTTGCAGGCGCGTTCGCTGAGGTGCAACGGAAGCGCGAGGCACTAGCAGGACTGG
AAGAGCGACTGGCCGACATGGAGCAGACTCGCATGCGAAAGGATCGGGAGTTTGCACGTCTGCAGCGGCACTTGATGGAGCTACTGgaagagcagaagct
ggagcttgagGACTTGCGCGAAAAGGGAATCGAGCTTGAGACCGCTACAGCCACatcggcagcggcggcggcagcaacagcagccaaagcACGCGAACAC
GAGGCGCGGTCGCATGCGATGTTCGAGTCCACTGAGGAGCTCATGAAGTTCCAATTCATGTCAATGTCGTTGTCGTACTTCAGCTCGCTCAACATGCTCA
AGAACCTGCGCGATATCAACGCGGACACTACTGCCGCGGCCATCACTACAACAGCGGAGACTGccgccactgctgcagctgccgctgccgccgccaacaT
TACACCGGTCACTGCAGCTCTCGCGAAAAAGAAGGTGGGTGGAGAGGCCATCAGTAACTTGCTCACTACTGTGGCtcagcgcaagcagcaagagctagca
caacagcaacacgaagaagaggaggcgtTAGCTTCAGGAAAACAACAGCCGATGCCCGAAGAATTGCGCGCATGGACTGTGGACGATGTGGGTCGATGGC
TCGACACTTTATCCTTGCCACAATACAAGACTGCGTTCCGCGAAGGCGCTGTGGATGGCGAGTTCCTCATTGAGCTTCGTCCCGAGGACATGACTGAAGT
TCTGGGTGTATCACACAAGCTCCACGTGCGCAAACTGCTGGCGGCCCGTAGCAAATTGCTGCCATTGACGGCGACGGAACGGACGCAACTGGATGCCGTG
AACCACGAGGCGAACGCAGCTCGTGCGCGTGGACAGGAGCCGACTGGAGGGGAAGACATCTCGTTGGAAGTGGACACCGTGTTCTCGCAGGCGCGCAACG
GGCGAATGAAGCGGCTCGTTGAGAGTCTGGACGCTGGATTCCCCAtcgacagcgaggacgacaagggcaacacgctgctgctgctcgcctgTCAGAACGT
GAACCAAAAAATGGTGGAGCTCCTGGTTGCGCGTCGAGCCAACGTTAATCACCGCAATGCGCAGGGCAACACGCCACTGCACTTCGCAATGGCCTacgat
ggcgaaggtgtCCTGGGCGAATACCTGATCGCACACGGCGCCGACGACACCATCGAAAACAACAGCGGCCTCACGCCCTACGATGGGCTCACGGCCGAGT
AAAacaggtattaatactactAGTGTCTCACATAGTACAGTAGTACTACATAGCAAAGCAACAAATTGGTAGAGACATTCGCTCCAGCTCGCACCGTTCG
CGACCCTGGGCGCTATATTTTTGCTGTTCATTCTGCTGGTGTAGTGAAGCATTCTTCACACCGATTAGATGATAATACATACGCACGGACCTATCCACCG
CAATCGTCGACGCTGAGACCTACGGTCGCTCGCGGCGAGGTCCTCGTTACTTGGATGTTGTATTCTCGTAAACTTAGGCGTCCACCCGAGCCTCTGCAAC
ACCACGTGCGTGCGAGGCCATCATGCGGTTTACAGCATTGACGTAGGCCGTAGCCGACGCCACCAGGATGTCGGTGTTAGCACCGTGGCCTACGAACTGG
CGGTCACGCGTCACACCCGTCTGCGCGTTCAcgtgcttctcgtcctccgtcttctcttcctcctccttgtcctcctgCACCCGCACAGTCACCTCACCCA
GAGCGTACGTGCCATCTGTCACACTCTCCACGGAGAAGTCGTTCAACTTGATGCTCTCCTGGCCCGTAGCACGCTTGATGGCCACGTAGATAGCATCAAT
CGGACCAGTTCCCATGGCAGCCTCGCTCACCTCCTGACCGTCCTTGTGCGCAAGCGTCACAGTAGCGGTGGGCTTCACCAGGTTGCCAGCAGTGACGTGC
ACGGACTGCAGCGTCCAGAATACCTCCGGCTTGAACAGCTCATCCGAAACAATCGCCTCCATGTCGGCGTCCGTgaccgtcttcttctcgtcagCCAGCA
CTTTGAACTTCTCCACGTAGTAGTTGAGCTCCTCCGGGGTGAGGCTGGTGtagccaagctgctgcagacgcttgCTGTACGCGTGGCGGCCAGAGTGCTT
TCCAAGCACCATCTTGTTCTCGCTCAGACCAACCGACTCCGGCAGCATGATCTCATAGGTAGCCTGGTGCTTCAACACTCCATCCTGGTGAATACCAGAC
TCGTGGGCGAAGGCATTCGAACCCACAATGGCCTTGTTCGGCTGAATAGACATACCAGTGTAGTGGCTCACCATGCGGCTGCAACGCATGATCTGCGTCG
AATCCACGCTCGTGTACACGGGGAAGTGCTGCGGGCGCGTCTTCAGAGCCATCACGAGTTCCTCAAGGGCCGTGTTACCGGCACGCTCGCCAATACCGTT
GATCGTGACCTCCACCTGACGCGCTCCGCCCTGCACAGCAGACAGCGTGTTGGCCGTGGCCAGACCCAGGTCATTGTGGCAGTGCGTGGAGAAGATAGCC
TTGTCGCTGCCCTCCGTGTTGTCAATCAGATAGCGGAAGAGCGATCCGTACTCTCCGGGGACAGTGTATCCCACCGTGTCGGGGATGTTGAGTGTCGTGG
CGCCGGCCTTGATGACCTCGGCGAGGACCTCGCACAGGAAGTCGGGGTCACTACGTCCGGCGTCCTCCGTGGAGAACTCGATGTCCGACGTCAAGCTCTT
GGCGAACTTGACGGAGTCCACGGCGCGACGGATGCATTCGTCGCGCGagatcttgagcttgtactTAAGGTGGATGTCGGACGTGGCCAGGAACGTGTGG
ATGCGGTGCTTAGGCGCATGCTTCACGGCGTCGTAGCAGCGCTGgatgtccttctccatggcgCGCGCGAGACCGCAGATGATCATGGGCTCGCCCGTGG
CGCGGTTCGCCGTGATCGGGCCGATCTCCTTGGCAATGGCTGACACGGCTTCGAAGTCGCCGGGCGACGAGATGGGGAAGCCCGCCTCGCACACGTCCAC
GCCCAGCGCGCTGAGGCTGCGCGCGATGTCCAACTTCTCCTTGAAGTTGAGCGTGGCGCCGGGCGACTGCTCGCCGTCGCGCAGCGTCGTGTCAAAGATC
ACGAGGCGGTCCTTGGATGCCTCGGCGGTGGCGGCCGCGTTCGAGAAGGCGCGGCGCGCGTTGGCCCTGGCCGCGGAGGCCGAGCGCTTGGCGATCGTCT
GCATCATGTCGAAGGGGCTATGTATGGGGCGAGAGTGCAGGTCACTTGTGTACGCACGAAATCGCGGAATGCAGAATGAGCGGAGCCGGAGCGCCGCTGG
TTGCACTTCTGAGGGCAGTTTGCCCAAACAACTGTGCTTGGCCGGTGCATTTTGGGGATCGtgcgcaccaccagcatcagtAGTACTGAttcagtaccgg
tatcgaTTCCGCTAGGGCCAATCGCGTCTGCGTGTTCGGCATTTTGACCAATGACAAAGACGAGTATAAAGTACCGTAAAAAGTCTGATGGGACGTAAAA
ATCTCTTGGCGCAGGTGACAGGCAAAGCACTTTTGTCCGGTGCTGCGCGCAGTGATACCTTGGTCAGTGACCAATGGTCACTTCGCCACAAGAATGGCGC
GCGAGCGTTGTCGTGGTGGCGAGCTGCGGGCGCGTAAACGTTTAACGCCGGCTTCAACACCGGCCAAGTTGGTGACACCAGCAACGAGGCCAACTACCAG
GTAGGCAAGTGGCACGTTCCTAGTGGTGCTGCCAGGGCCTCAACGCCAACGCGGTCAGACTGGTGCGGGAGTAGGGCTCTGGCACCGAGGGTTTCAGCGA
TCTGCACACCCCGCGGCTTTGTGTGCATTGCCATGGAGTCCTTGGCAGGACGACTGCCAACCATCACGCCTGCATCATTCCGTTTGATTAGACTTGCCGG
TGCTCGGTGCTTC