Description :
From Genome Similarity Track
Location :
Scaffold_1:19445- 49538
Transcript NameFunction/comments
Phyag_g9hypothetical protein
Phyag_g10hypothetical protein PHYSODRAFT_309032

Sequence
30093 bases(100 bases per row)
TGCTGGtatcgttgctgttgatgtgcTGTCGGCCTGGTGCGGCCCAAACCAGTGCTCAGATCCTTTCGCGGTCAGGCTGCGGGTGTGAGCCGACGTTTTT
GACCGATTCAAGTACATTTGTGACCTGCCATCAAACAAGCACCAATTCTGCGTTGGGGTGTGCAGTGGACCCTTCCGATCCCTGTGCGGACGGTGTCTCG
GGTCGAACCTGGGATCTTTGTAATGGTGGGTCGGTCTTTCGTTGTTCTCCCCAGACTGGACTGCTTTGCTTCATACTTACACATATTTGCGCTGTGCACG
CTTGTTTTGTTAGTTGTCAATTTGTATCTCGTAACAGACCTGACTTTATCCACTGCATCGACTGGAGCGCTTCGTGTGACGTTGTATGGTGACGAACTAG
CTGAGCtgactgcagcagatctGTCGAGTGACATCCTTCAAAAGCGGATCTCCAAAGTTTCTCTCGTGTTGGAtagagaagctgcagtcaaGTCGATCAA
GGTATGTTGGCTGCACTGTCGCCATTGCTGTTCAGCTCACAAATTGTTGCTCGATAgattgaagctgcagcgaataTTTCGCTTCGGATCTTTGAAGTGC
AGACAGCGGTGAATGACTTGCCCACTACGGTATtttctcctccgtcgtcggAATCAATTACCTTCGTTGACAGTACAGCAAACTCCGGTATCGTGTTGCT
GTGGTTTGCGCCAGTGACGGAATTCTTAAATGGTCAGCATTTGTACAATCCTGCGATAGAATATGACCGGTTCGGACTAACATGATACGCCTGTCGTAGG
CGTTCTAAGCGAATGTGTGTTCGATTTGGTGGGGCGTTGCGGCTATCATGCCGATCTACAAGCGAGTTCAAACTTGCTCTTCCTAGCGGAAGACGGAAAT
GAACCGATTGTAGCAGCTAAAGCAGTTTCTGGACCGGCGTTTCGGCGTTTATCCGAAGTGAAGAATCCCCCTGAACCTCGCTCTCTCTCGTCATTTCCTT
GTTTGGTTGATCGCGCTCGTTACCAGCGGATGGCGACCTCCAGCCCATATCAAAGCTTTACTTTGCCAAGTGACCCGGTGATAAGCGTTTTGGAGAATCG
ACCGGTTGAGGTTCGACTAGAGGATTTACTGGAAACGATCAGACAGATTCGAGGGCACAGTAAAACGACGAGTCTCGTGTCTGTAGAAACAAGATGGAGC
ACCACGAGTGCATTTGGCTATGCAAAAATTGATGGTGCGTCGTCAAGGGAAGAGGTAGAGGATGAGAGTTTTGTAACGTTTTGGAGATTACGGCGTCGCG
ACACGTTAGTAAAGGTTTATGTCGTATCGGGCTttgttggcgaaggcgaTTTTCTAATCCAGGTTGGCCTCAAAGAAGCAGGAAAGGTGCATCAATTCAC
GAAGAAGGTCTACGTGACCGTCGAAATAGACCCTCAGCTACAAACTATTGACGAAATCGATTTAGAATCCGGAAACCAAGCATCGACCGCAGCTACTGAA
GACAAGGACATCACTGCCAGAACTTACGCTATCGAGCCACGTCGACTCGATTCTTTGGATACATTAAATTCGGATGCTACTATCGTGGAATTGCTACCTT
CAGCTGTCGATTTACATGACGGCGTCTCCTTTCGTCTTTTGGCTTCAGACCTTTCCCCAGACTCGGACTCTGATTCTTGTCAGACGTTATTTACTGTCTT
CTCGTTGACTAATGCCATTGCAACAGTGGAAACATCATCGACAGGCGTCCAAGACGTATCCAATATTCACGATCCGACTGTAGCACATCGTTGCAGCGAT
GCTCTGTTGATCTCATTGCTGGCCGACGTTGTAAGCGTCCGGATTGAGATTCACGTCAGCACGATAGGTACCGATAGTAGTGTGACTATGGTCACCATTC
CTGTCACTTGGACTGTGATCCCTCGCGTCAACTTACCAGTTACTAACCAAATCCTTCTTGGAGCGCACAACATACCGTGTGGCGAGGTACTGGAGCTAAC
GCTGAATTACGTGGAAGTACTGACCAATGCTAGTGTGGAGATTATTGTCAAGAATTGTTCTTTTTTGAGTGTCAACCCTACGGGCGCTGCAAATTCAACG
AGCGAGGAATGCGCTTTTCTCCTGAAAGATAGCAGCTCTGATGATAGCGATCCTATTAGTGGAATTACGATAGCTGAGAGTCAAGACCAAGCTACTCCTG
TTTCTGTCGAAGTGGCTATATCTCAGTTCGTCCAAGGTGATGATGGTATTACTTGGACAGTCGCATCGTCCACCTTGGTATCATACGACCTCCATTTTTG
TGAACCGGCGACGACAAGTGGTGGACCACTCGTTTTACGTAACGGGGAGAAAAGTGATACCAATCTCGCTTCACTCGTAATAACGTTCTTTGGTGTTGAT
TTACCTAACACTCAGATTCCCAAAAGCATCTCATTTATCATGGATACGACGCTGTTCTCTACTGTGGGAAGACTTTTCATCAATAATGCACTTGCTCAGG
TGAAGCCTTATAATTCTACTGCTTCGTTCATCGTCTTTGATGGAGatagtggtggtggacttTCGTTCACCCCATCTGAGTACGGATACTTTCTGGTCGA
TGTAATTTTGGAGTGGGAGAACGTAGACGACCCTGCCTCTGGTTGCTTCTTTCTGCAGAATTTTGTGGTATCAGTGATGCCTTTATTTGCACCGCCAATC
TTTGCTGCTCCATATGCTTACAGCAAAAAAGTTCTCGAAGGCTCTACAGCTCAAATAACTATCCCGATACTGGCAGCCAGTCTTCCAGAGATCGAATACA
TTACTCTCGTCGTAACACTGAACATCACAGTTGATGGAATCGTCATCGAACGTGACGGTATCGAGTACAATCCTTCGCCAGGAGATGATCGCTATTTTAT
CCTCATCCAACGCGAAGATGATTTGGATAGTGCGAGACAAGTTACCTTTTCGGTCACGCCAAACAGTAATTTTACAGGGGGCGTACGGTTTTTCTTTGCT
GCCTCCGCGATCGGCTTGGTGGAAAATGTGACTAATTTTACAGACCTCGGGGTCGAATCATCTACAATACGCGAATTAGACGTCGAATGGATCTCGACTT
CTAGTTCAGTAACTGGTCCAGCCGCATCGGGTGATGCCGTGTACCGGAGCTTGCCCACAAAATTGCAAGGCGATTCAACACTTTCGTTCAAGTATCAAAT
GTCATCAGGTAAGGGAATATTTTCTTTCTAGCAATTGTCCACGTTCTAACCGAAACATTTTTTGTGTGATTTCGTCAGATTTCTCGCGTGTCAGCACGGA
AGTAATGCTAAATTCAAGCGAGACCAGACAAGTGTGGTCTAGCGATTCTGCCGTTACTAGTCAAAGCGATTGGAATCATGTCGAAGCAGTGATTATCATC
TCATACGCTTCAATTGCTGAAATTGTTTTTCGTGGCGTGGTTGCGGTAGACGATGCACTATACTTGAAAGCAATCAAGATTCGCGACTACGTACAGGAGA
GCATGGCAGGCGAGATTGAGTTTGTTCGTGCGACTGGCGGTATGATTTACATCGAAGTCAACACCACAAAATCTATCCCAGACCCCATTCTGTTTCGGGT
TTAtgtcaagaagacgaacaccACCGAGGCCCCAGACCTCCGCGTCACTGGTAAGATCATTTAGTTCTAACGTTTGCCAGCAATGTGTTCTAATTTTTCG
CCATCTAACGAATTAATTCCTCACCAAAGGTGACGGGCTTCAGTATCTTGGTTGCAAGGATACCACGACAATGTATCCATGCACAGTCGGTTCGGGCATC
ACGTTCGAGAGCCCCAGTCAGTGCAGAAAGCCGTGTTCCGCCGTTGAAACCCAAATTCAGTTTACCCCCGATTCGATTGTGAGAAGTGCGCAAATGATGT
CTCTCTCAAGTATACAAATGACGCCGCTGCCGATCATCAATGCGTTTACGATTGAATTTTGGGTGTTTTTGGAAAGCCTGAGCTTCAATTCCAGTGATCA
GCaacttttgctgctttttggTACCCTGGATGCGAGCCTGAGCGTAACACTAAATCGTGATCTGCTGATATCTTGGTGTCAAAACCAGCTTCGTGTTCCC
CATGGACTCCCACTGCAAACATGGGCACACCTGGCACTTGTATTTGGCGCAACTAATGCGGTGACTGTATTGGTGAATGGAATCAAACTAGCTGAGGGCC
TACTAAGCAAGGAAAATTGCCTGATGCCACCATACGCGTATCTTCAGCTTGGACGAGGCACGATCATAAAAAGTTTGTACTGATGCACAAGTTACTGACT
TAGTTTTGTTACATTGCATTTGTTTTGTTGTAGATGCATTGAACATTCGACAGGAGACAACTGTGTTCCAAGGTGCTATGGACGAGGTACAGCTTTTAGA
TGTGCGCCATTTTATTCTTTTCCCTTTTCTCACATTCTATGTGTAAATTAGGTTCGCGTTTGGAGCGTGGCCAGAGATCCAGCAGATATCTATTCTTCGT
TCCAGAAAAATATTGTCGATCCTACTTTGATTCTTGGTTTAAACTTTAACTCTGCCGAGAAGACAAACTGGTTTCCGTCGGGGGCAGATGGGAGCGGCAA
CACCGTGGACTTTATGGCACAAGAAGTGAATACTATCAATACGCGGCCAATCCAATACcttggagttgctggagatggaagTTGCCACTACGAATTAGTT
GCGTCTGCCGCCGAAATAGCTTCGGTGTCCTACACGTGCGATAAGACATGCGGAGATGGAAGTATGAGAACTTGTGGGTCTACAACTATCAATAAGGTGG
CTAGTGTCTATGGAAAAGGCCCTATCGGAGTTGGTGGGCTTGATCCACTTACAGATTACGACATTTCGGTCGAATTTGTGACTGGAGACGGCGATGAATT
TGAAATCACCAAGCCATTAATTGCTACCACCGCGAACGTGACAGTTCCGGGGAAAGTGGAGTATATCGGTGTCGTGGAGCAGTCAGATCAGTTGGTTGAA
GTCCAATGGAGCCCTGTCGATGATGATGGAGGGTCCGAAATCTTGAGCTATTATATCTTTTTGAACGAGGCAGAAGTAGTAAATACTGGAGATGGAACGA
CATTGTCAGCGACGTTAACTATCGCGGAATTCCAGGTTAGCTATGAAATAACAGTACAGGCAGAAAATGCTCAGGGCGTGGGTCCTCAAAGTGACCCGCT
AACTTTGACAAGTGTGTACAGTGATTCTACCCCAGAGGTACCACAACGCCCAACAGTGTCATTGGTATCTGGAGGAACGGTGGTGTTTGTGGTGGATGAA
ACAACCAGGTTGGCTGTTGCAGAGCGTTCGTCTGAGCTTGTGATTGAGCAACGCGAGCCCTCTGTCACATTTTTCACGACAGCAGTGTATCAGCTCACTG
ACTCAGTCGCGACCGTGTACAAACTACGCCACAATACCGTCTACATCTTTCGTCTGAGCGTGATCAGTAAATCTGGCGTGCAGAGTGGATATAGCGTCCC
CATTTCAGTGATGACTGGAAGCAGAGGGAACCCAAGCAAGTCATTGTTGCCGACAGTAGTCCAAGTCACAGGTATGAATTACTTGTCTTGATTTGCTAAC
TGTCCTGAATTATGATATATCTGTATGTTCACTACAGGGGGATCGATAACACTACTACTGGAGGAACCACTCGATACAGGTACTTATTAACAAGGTCTTC
AAATATTCACTAATGTTGCGTCTGTCTTGTGATGATAGGCGGGTTACCAATTGCTCAGTACAACCTTTTTCTGCTTCAGAATGATTCCTTTACGAAGTTG
AAAAGTGTTGTGGCTTCCAGTACAAGTGAAACAACAACTGTTATGGTGACTCATGATGTAAATGGCACCCCTTTACTTGCATCAACGTCATACACTATTA
AAACGTTGGCGTTGCAAGCCGATATCGTCTGCGACACATTAACGGACGATGGATTGGAAAGTGACGCTCTGACTGTAACAACCGCAATTGCCGCTGTCCC
GGCACCACCGTCACAACCAGCGCTACTGCTACTGTCGGGATGCACAGCATTGGTAACTGTTACTTTTCCCGAGGATTTTGGCGGAACGAATGTTACCGGT
ATGACTATAGGAGTTTTCACAGCAACAGGACTTTTACTTGAGACCTTCGTCTCATTTGACTCCAGTTCGGTCACAGTTCGAAATCTGCTTGCGAATACGA
GCTATTCTGTACAAGCTACTTTGAATACGACCATCGGCGACTCTGGGTTTGGAGAAGCATTGACATTCACAACGCAGGATCCGAGTCCACCAAGCAAGTT
ATCCCTGCTTCAAGTCACTGATGTTGGTTCGAGTTCCGCGACTGTGGTGTGGGGAGGACCACAGGATACAGGGGGAGGTGTTATAACAGGTGATGTTTTA
CGCATTTGTACTGGTTGTTGCTTGTTACTTGTTACTAGAAAAATAACTGTTTCTTCGCTTTGTCTCTAGGATATCTACTTTATCAGCGCGCAGTCACAAC
ATATACAACACAAGTGCTCGTTTACAATGGGTTATCCAGCACGCTTTCGTATCTCGTTGGTGGGCTTTTTGCTAGCACTCTATACATGTTTTCAGTCGTT
CCGATTAATCAGTACGGATTAGAAGGTCTCTACAAGGACAATGTCTTCACCGCTACTACGTTATCCGCTGAAGTACCGTTTCCCCCAACTAACGTCACCC
AGAGTCAAGTCGATGGTGGCTTCATGGAATTATCGTTTACCGAGCCATTCTACACCGGTGGAGGACCAGCCAGCTCTCTTACGTTTTCGGCGCGTCTGCA
GTCATTGGTTTCTTGCTTCAGTAACGACACTTCGAATTGCTCAACGTGTTCGAATGCGTTGGTTTCCGATGACTCTACTACTACTATCCGATTGATCGAT
GTGGTGTCAGCCTCATGTGCTACGAGCGCTTGCATTGATAATGAAAATTGCTGTTTGGAAGATGGTACCAAGTGCGGAATTTTAGCGACTACGGCGACGA
AGGAATGCACACTAGGCACTCAATCTGGAATCTGCCGTGTCGAAGGATTACATTTCAGCACGGCGTATATCACAGCCTTAGCTGCTGTGAATTCTGTAGG
CGCAAGCCCCTATTCCAACACTATTGTGGTCACCACGAGTGCCGCCCGACCGCCAGGATCTCCACAACTTAACGCCGTGTCGGCTACGGGAGGGTCAATT
ACGTTACAATGGACACTTCCAGCGGTAAGTTCGATGTAATACCGCTTTGTTGATAGGCAAATTAATGCGTACCGAATGTTTTGATGGCTTCAGGATACCG
GAGGTGCTCCAATTGTGCTAATGTCACTAAGCGAAATGGGAGATGAAGTGTTTGCTAGCGACGTTGCTTTGACCTATACTGCTTGTGGAGGGCTGCGCGC
CGACACGGATTATGTATACGCGATCGATATCGAAAATGAGGCTGGATATGTCTCCCAAACGATGTCTTCCTTTATGACGACTGGAGCAACTCCACCAAGT
CTTGTGGTGCTTTACGAAACTTACGTGGGAATGCAGACAGCgagttttgctgctgccttaTCATGCGACGATGGTGGCACTGGCGAAACACTAACTGCAT
CTTATCGCGTCTTCCAAGTCGGCGATACAGCTACATCAATAGAAGGGGTCGCCTTTTGTTGTACACTCGGAGACACATCGTGCTGCTCTCCCAATGATTC
AACTGCATCAGTTGAAGGACCTCCTTGCTGCTCAGTCGAACTTTCTGGATTGATTGGGTCGACCGATTATCGCGTCGAAGTTCGAGCCCAAATCTCAACT
TTAAATGGCAACTGGGCAACAATGGACTTTACAACAATGACTGGAACCCCCTCCAGCCCAAACACATCTCTGTTATACGCGACCCCGACAGCTTTGGGAT
TGTCACTATTACCTCCTTCAGACACGGGCGGCAGTTCACTCTCACTCGAGGTGGTAGCAACGAGTATTGCTACTGGAGTATTCGTTTACAACAATTCTGT
GGACTGTCCGATGGTAAAACTGGAGTACGCTTGCCCCAATACGCTATCAATTGACAGTATTAACACTACACAAAATGGTTTCTCGTACACTGTGGTTATA
AGAGCTGTTGGTACCGGTGGAGCAAGTGCTTGGGTTTCAAATACGTACGATCTCGACAATAAAACAGCAGGCATGGTTGGATTTGTTCAGCCAGTGTATC
GAGGTACCGAAGGCGAGGATATCACTGTGCAAATCACGCGAATGTATGGAACATCGGTAGTTGAACAGACAACTTTTGATATAACTCCGGGGGTAATTGT
ATCATCATGGACTTGCTCTCCAAGTTCTGTCGGGGCAACCTGCCAAGCTGACGTAGCAGGTGACAATCAGGGTACGTACCAACCAGAAACGTTTTCCTAA
TGATGATAACTAACCCCAAAAATGTTTTTGCGCTCAGGATACGTCACCTTCATGTCTGGCGAGTATACGAAGACGGTCACTATTTCATCGATCGACGATG
ATCTGTATGAGGACCCACCTGCTGCGTTGAACCTTACTCTTGTGAGCTCAGAGGTCAGTGGCCTTGGTCAAACCCAATGCCAAGTGATATTTGATGAcaa
tggagacgctggaaaCTTGGGCTTTGCCACAATACCTATGAAGGTGGTTGAGAATGTGGGAACACTCAATATTGTTATTTCACGTACGGGAGGGGTCAGT
GGTAGAGTATCTGTGGTGGTGTCATCAACTATGAGCTCGAGTATCAGTGGATTTAAAATCGATCAAGTCGTGAGCTTTGAAGATGGTGTAGCCAACGCAA
GTGTACCTGTTTCCATCCGAAATAGTAGCGAATACGAAACGCGACACTTTGTGGTAATGCTCTCAAATGCCACAGGTGGTGCTGTACTGGATGGAATTAA
TTTGTCAGTGACGGTTGAAGATCAGGGAGATGCGGGTCCTCCTGGACTTCCACGTGTCGCGCAAGGACCAGCCACTGGTGGATGCACTGAATTGGATTTG
AGCCTTCCGACGTACATGGGTGTAAAGGGCTACTCTTGGTCTCAGTATTTTCTCTATGTTGATCAGCCGGGGAGTGGCGTTACTCTACCGTATTTTACCA
TGTCGAACAATATCAGCATCTGTGACCTTGAGTACGATACAACCTATGTGGCGAGTGTTCGGGTTAACACTAATCATGGAAACGGTGAATTCCGTAGAAT
TTCCATTTTAACTGGGCCACTTTCAGCGCCAGGTCCAGTTGATCGCTTCTACGCTGGGATAGTTACAAGTGGTTCGGCAGGGGTGTTTTGGACAGCTCCG
ATTGATAAAGGCGGAACTCCTATAGAAAGCTACCAAGTTTCGGTCTTGAACGAAGCTACGAACGATGTACGGAACATTGAGGTGCCTGGGTTTCAGTTGT
ATCTGTCCGTCGGCATGTTATCTGCTGGGACATCGTATACATTTACTATCCATGGCGTTAACTACGGGATGGTTGGCCAGAATTTCTCTATCAGCGTGTC
GACTGATAGTCTAGTAGTAACACCACGTCAACCGCCTCCACCCGACTTGATTTCCGCTACGGGTGGAGCTCTACACGTCGGAATACTTGCACCGAACGAT
TGTGGTGGATCCCCGTTAACTACCTACGTCCTCAATATTGCTCGAAACATGGGAGGAAACTTGGTCTACAATCAATATGCATCTGGAACCGTTGAAAGTT
CAACCTTTGACCTGTATGTCGCGAACGTCTCCATCCATGGTCTTCTGTCCAAATCCGAATACTTCATTACGGTATCACTGCAAAATGTGCAGGTAAGGCA
TTAATTACGAATGTGAGTTTAATCCGAAAACTaacatttctgctgctgtttctaGGGGTGGAGCGAGCTAAGCAATGGACAAAGTTACTTTACCACAGCG
CCGACTCCCGTTAGCGGGGTGGCCGCACCAACAGTTGTCTCTCAGGATCCTGGGGAAATTACGCTAAACTGGGGAACACCACTGGACTCGGGTGGTCTTG
ACATTATTGGGTACAGGGTGCTGGCACGCTACCAGTTTGAAAATGGTTCCTGGTCACTTTCCGAAGTTGTGTACGATAACCAAGCCTCGGTGGTACAAAC
CGTATTGATCTCGAATATTCTGCCTAATACCGAGTATGCCTTCAGCGTCATAGCGTATAATTTCCGAACGTTATGCCGCCCCGATGAAGATATTACTCCT
GGGGATGAACTTCTCATCAAGACACAGGATGGCTCTGTGCCGTCACAACCAAAAGATCTTCAGGCGATTCAAGTGACAGGTGGATCTGTTATTTTGGCAT
GGGACCCCCCTCGGTCTTCAGGGGGAAGAGTTTTACTTTGGTATCTTGTCAATGGTAGCGCTGCAGGCAGTCAGCTTCAATTGATGGCGAATGTCAGTGC
GACTGCCTCAAATTCACTCACGCTGTATGGATTTATGGCTTCGACACCGTACGAATTCGCAGTTGCTGGCCAAAATGCGCTAGGTCTTGGATCGTATTCG
TCGTCAGTGGAAGTGACTACGACAGCTGCAAGTTCCCCCGGCCCCCCGAAATCTCTGCGCCAACTGGCAGTTTCGTCAGGAGGAACAATCATATTAGCGT
GGGAAGCTCCTGACGACTCGGGTGGGGCTACCGTCCAGGAATATAGTGTACTTCGTGATGACATCACAGTTGGTATCGCGACAGCTGTCAATGGAACCAC
TACGTTTCAGGACCAGAACAGTATCCTGGCTGACACGACCTACGTTTATTCTGTGTCCGCATCAAACGACTTTGTCCCCGGTACAAACCCAGCTAAGGTC
ACCGCTAATAGTGGTGCTGCGTCGGTCCCAGCCCCTCCATCGGGAGTCGTTCAACCTGGGAGTGGGTTTATTGTGGTCAATTTGACGGCTTCACCAGATT
CAGGTGGTATTCCCATCCTTGGTTTCGAACTAGCCGTGCTGCGTGGAACAGCGATTGTGAATACTTACACCACAACCAACCCCGTGTTTACAGTGAATGG
GCTCTATGCAGTTACACAGTACTCCATTCTTATCGACACCGTCAATGCGGTGGGTAAAAGCGAGTCAAGTATGCTGACTGCTACAACAAAGCCAGCTACT
GTTCCAGACAAGATGTTGGTTCCTAGACTGGTGGGCGTAACTGGAGGTTGTCTACGGTTTGGAGTTGTTGCACCTGCCAACTTTGGTGGTAGTGACATTG
TGGCCTATCGTTTTTACCTAAACGGAACATTGGACGAGGCTGTGGATATATTGAACACCGAGTATGATCTTGTGGGATTAACGGCACTCACGTTTTACGC
AGTCACCGTATCTGCGGTTAATGCTTTCGGCGAAAGTGTACAAAGCGATCCGTTAATAGTTTCGACCGACGTTGTTACAGTACCTGGTACAGTTCTGAGT
CTAGCAATGGTATCAGTAACGCAGGATGCAATTGGTCTTACATGGATGTTGCCGCACGATACTGGTGGGGATGCAACTGTAATCCAGTATGACGTTCAAT
ATTCTCCAAGCGCAGGTGATATCAACCAGATATCCAGTGGGTCTACCGATGCGGTATTAACTGCTCTTGATCCTTCTACACTTTACATTATTCAAGTTCG
AGCCACTAACATGATGGGGGAAGGTCCGTGGTCGGACAGTATATCTGTAACGACGGATCCTGTATCGCCCGGCGTCATTAATTTTGCGACAACATCAGTT
AACGTATCTGAAGCTGGTGGTTCGGTTACCTTGACACTGCTTCGTACCCAGGGAGGGTATATGCCAGCGAAATGCACATACCATACAATCGACGGAACGG
CGATTGCCGAGATTCACTACGTGCAATCCAGTGGTGAAATCGATTTCGACCGGGCTATGGGATCCCAGCAATTCAATATTAGCATCATCAACAATGATGT
GACCGATGATCCAGACAAATATTTTTTTGTCATAATTGAAAAGTATGATACGGACTCTGGAGCGATTGGAGACAACGCTACAGTGACAGTTACTATTACG
GACGATGGTGATTCCGGTGTGGTAGCTTTTGGACAAGATAACTACTCCGTCTCTGAAGCTGTGTCGACACTTGCTGTGGATATTGTGAGGACGCTGGAGT
TCAGCGGCGGTGGTACCATCGCAGTTGATGTAGTTAACACTCTTGGAGACGCTGTCGAAGGTACCGACTTCAATATTCCAAATAAAACCGTCGTATTCGT
CGATCAACAACGGCAAACCTCAGTCAACATCACGATCCAGAACGACTCAACGTATCAAGCACAAAAACTTTTCCATCTGACGCTTCGTGTGGTTAGTGGG
CGAATTGCTATTGCCAATTCTACAGTTACTGCTACAGTTGAGATCTTGGATGATGGAGATACTTCACCACCAGGTTTAGCAGGCGCGgttcaagttgttg
cagtaTCAGGAGGGGTGATTAGCGTTTCATGGGTCGCTCCAAATTACTTAGGAGCAAAAgtggtgccgtcgttggcgtATACTGTGCGTGTAGTGGAAGT
TCAGACTGGAACATCAATGGAACAAATCGTCAAAACTGTTAGCCTTATAGTTCCGCAGCTCAAAGCTCGAACTGCGTATGACGTCTCGATTGCGGTGAAC
AACACTTACTTTTTGGGAGAGTACACAACTCCAAAGTCAATTTTAATGGATGCGCCTACACCACCATCAAAGCCCCTGAATGTTCAAGTTTTATGGCAGA
CAGGAGGAATGGCAAATTTATCGTGGACGTCTCCATTtgacggaggtggagctAATATTACCAGCTATCAAGCAAAAGTGAGCTTTAGCGCCAACAACAC
CTTTGTGGGTACATACATCACGACAAGCGGCAACAACATAGCCACGAACAATCTTTCCTCGTTGACCAGCTATAGCGCAACTGTCGCTGCTATCAACCAG
TATGGACTCGAAGGAGACCTAAGTAGCGCAGTCTTGTTCACGACCACTGCTGTGTCCATTCCAGGAAAACCAAACTCTTTGGTGGTATCAAACGTAACAG
GCGGTGCATTACAGGTGGATATGGCACCTCCGCTGGATATGGGTGGGGCCCCTATCCTTAACTACACCCTAGCGATGACATCTGCTAAAAACCCGAAAGT
ATTTCACCGAGTTTATCGAGGCccttcatcgtcattttACGCAACCCGACTAACTTACTCGACAACGTACAAGCTGCGGTACAAGGTGGCCAACTCAGTG
GTGAGCTTTTCTATAATTCTGCTCTAATTTCGCGATTCAACTTAATTAATTGTGCTTTGGGTTTGTTTCTATCAGGGAGCTAGCCAAGTGAGTGATGTGG
TTGTAGCGGCCACGAAGTATCTGACACTTCCAGATGAACCACAAAACATTGTGGCAGTATCCCGGACGGGAGGTTCTGTCACGCTTTCCTGGTTACCTCC
TGTGGATTTTGGTGGTGAGGATATTACCTCGTACGATGTAACGTTTTTCCTTGGTTACCAAGTCAGTACTCAGTACCAGGAGCGCGTATCGGGGTTCAAT
GCGAACGCAACGTTAATCACCGCAAAAATCGTGGGGCTGCAGGCAAATTCTACTTACGGGTTTTCTGTGTCTGGAGTTAACGATGTCAGTGTGTGTGCCA
ATCCTTCAACTCTGCTCACCCGTACTATTATTTACAGTAATACGGATCCATTAGTCTCTCTTCCAGCTATTCCACGTGGGCTTGGAGTGGTCAAGAGTAC
GTCCGGAATGCAGGTTGTACAATGGTCTGCTAGTGAGGACACTGGAGGTGGCTTGTTTGTAGCTTACTTGCTGTATTCAGATACTGGTGGAATCTTGTAT
AACGGCACAAATACTGCATTTACGTATGGATCGCTGACTAAGAATACGGTGTACGGCTATCGGGTTTGTGCGTGGAATTCTGCTGGAACAAGCTTACTGA
GCGCAGTTGTCTTCGCAAGTACGCAACCGAGCCTTGTTGCTCCCAGCGAACCCCTTCAGCTCGCTTTAACTAGCAGTACAGGCGGCTCCATTGGGCTGAC
GTGGCAAATGCCACTggacggtggtggagatgcgATTTCGGGATACATACTGTATCGTAACACAGTTTGGAGAGCTGGAATTGCGGCGAATGGCTCTACG
TTGATATATCTGGATGAACAGGGCCTCGCCGCTCTGCAACAGTACGTGTATGTTGTTGGTGCAACAAACTCAATTGGACTCGGCGCAATGAGTGAACCAC
TCACTGTGTCTACAAGTAGTGCGACCATTCCTAATCCACCAAGTGGAATAAATATCGTTGCATGGGGTGGGAGTCTCACAGCGAACTGGACTGCTGCGGC
AAATTCCGGTGGAATACCTTTGGTTTTTTTCCGTCTGCAGGTTCTGGTGGATTCACAAGTTGTATTTACCACGACTACTGACGTTTCGGAGTACACACTA
TTTGGGCTACGAGCCAGTACTACGTACACAGTCATGGTGACTTCTGAGAACGGAATTGGGGAAAGTTTACCCACAACTCAAATTATCACTAACGGGGCTG
CTGTACTCCCTGTTGCACCCGCAGCTCCTGAACTGTATACAAACTCGACAGGATTGTTAGCATGGATGATATTGCTGAAGTTATATCTCCCGATTGATGA
TGGCGGAGCGTCAGTTGATCAATTAGTCGTGTATCAAAATGGATCAAATATCCTGTCGTACCCGGTAAATGCAATCAGTCAAGCAGCGCTGGGAGACCCG
ACAGTTCGGTCGGTGATAGCTGAGATAGGCCCTTTACACGCAGCCACTGTGTATAATTTCGCCGTTTCCGCTGTTTCTTCTGTAACGACAATTGGCGAAG
GTCCGCGCAGTGACGCTCTATTCGTGATGACCGACCCTGCCACACTTCCGTCTCAGCCGCTTAATGTCATAGTGGTTCTTCGGACATCGTTTTCAATTGT
CCTACGATGGGACAAACCAGCAGACACTGGCGGGGATGATGTCGTCTACGAGGTTGCGTATACTAATACGAACACTTCGGTAGCTGGCCAAATGGTGGTC
AATACTACAACCGTTGAGATTCCTCAATTGATTCCGGGAGATATCTACTCGATTAATGTGCGCACTCGAAACTCAGCCGGAACCAGCGTTTGGACGCCAG
ATGTATCAACTCAAACCGACGTAACACAGCGTGGCGTCGTTATATTCAACATGACGTCTTTGACTGTGTTTGAAAACGTCACAAGTGTGGGAGTTCAATT
ACTTCGCGTGAATGGTTCTTCGAGCACGATTACCTGCAGCTATTATCCTGGCCCAGGCTCTGCTATCTACGGCCAAGACTACACGTTACCACCCGAATCG
GAGCGGTCTTTCACGTTTGTTGGGGAACTCATCGTACAAAATTTCACTGTACAAATCATTAACGACGATGTGTACGAGCCGACTCCACGGACAATCAACC
TAATTCTCACAGACACTACCCCTGGTCGTAGTGACCCATTCCCACCTACGTCTCTTGTAATTACCATTCTGGACGACGGAGATGCTGGAATGATCGGGTT
TGTTAATAGCGACGTTGCAGTGTTGGAAAACGCTCGCATATTGACTCTTCCGTTGCAGCGAACGAACGGAAAGAGCTCTGCAACTAGTGTCCATATCGTC
CTATTCACCGGTCTCGCCAGTACAGCTCAATCTAATGCATTCCGGTTACCAACCGCAACTGTGGACTTCATCGATGGCCAAACCTCGTCGATTGCGACTA
TTGTGATCATCAACAATGATGTCTATGACTTCCCGTTTCTGTATTTTTACCTCACACtggaaattgctgctggaggtgcaaCGATTGGAACGTATAGCGT
GATTAAAATTGTAATACTGGATGATGGCGATCACTCCGCGCCTGGAGTGATGGAGGCTCCAGCTCTGGATAAAGCAACTGGTGGAATGCTTCAACTGACG
TGGGATCCTCCTGTTAACGTCGGTGGGCAAGATATCTGGATTACGGGATACAACATCTCAATTCTCACCACCAACACAGCGAAATCGCTAGTCACACAAA
CCAACGCGACGGTGCTACCGTTTGGCGGGTTAACTGTGCTTACAACATACGATTTCACCATTTCGGCAGTAAACGTCATTGGCCGTGGCATCGGTAGTCC
AAGTGTGGCGTATTCGACTACGAATTTTACTGCGCCTGGACCAACCGCGCAGATTGCGTTGCTTAATCGTACGGGTGGTTTACTCACAGTTGCGGTCACT
CCCCCAATCGACAGCGGTGGAGCTTCTGTAACCGGATACATGTTGTATCTGTCACAAGCGGGTGGAGATTATAAGGTTTGGATAAGGAGTCTAAGGCTGA
TGGTGGCTTGGATCTTGGACTAATAAGTATTGCATTTTGCTCCATGCAGATGGCTTATAATGGTACAGGGCAGACCCCATCGGTGATTTTTGTAAGCGTT
AATAAGGCGAACACTAACTATACCATCCAAGCACAGGTTTGTCGATTCGCTACGCTTAGCCGGAATTGATGGCGTAGCTGATTGTCATTTTTCGAATTTG
TGGATAGGCTATCAACATCATCGGAGCAGGGGATATGTCGGATCCATTCGGGTTTACGAGTGGGTCACTATCGCATCCAGGACCCCCTTATCTTCCTGAT
GCAGCTGCCTCACGAACAGGAGGAGCGATATCTCTAGCCCTCATACCCCCTATTGACACAGGTGCATATCGATTCCAATCTGGTTTGCAGTAGTTGCTAC
ATGCGCTGATGTTGCAATTTTGTGAAAATACAGGTGGCTACGATGATGTAACTTACATGATCTATTATCGAGAGCATGGTTCAGATAAAAGATTTTGTGA
GGCTTatttcgacgacgaggacctgCAAATAACTGTTTCCCGCTTGGCGGCAGAAACAACCTACGATATGATTGCAGTATCGCTTGTCGAGAACGATACG
GAAAGTTTATCTATGGGCAATCTTTCAAtcgctgcatccagcattGTATTCTCTGGCAACGTATCAGCTAAACTGGTAGCAACAGGGTACTTCGACTTTG
GCGTAcgtattttttttttcttcggCTCTCGTGACGTGCTCTAACCGTTGTATAAATTATCTTATAAATCCAGGGATATATGTTTGAAGTTGACACATCG
CAAGCCAATGCAGGTGGTACGATATATTACTTGCCTTCACTGAGTACCGACAACGGAGCAATTGCGACTACAAACCTGGAAAATTACGCAGTCTACGCCG
GCTTTGTTCGCGGTGCGTTCACTACGGTGGCGAATTATACAACTACTGGCCCTACAAGACCAGGGAAGCCTCCAGATCCCGTTTTGAACTATTCTACTGG
CGGCGCACTGGGTTTTAAAATTTCATGGCCAAACGATACAGGTAACGATTGGGATCGATTCGCTGGAAACGAGAGGAACTAACACGTATGTGGATACCAC
CAGGCGGCATCTCAATCTCAGACTACGAGTTTTTTATCAACAACATATCGGTAAGGTGATAGTAACATGCTTTGGTGGTATATGGTACTTTACTGATTCA
CGCGGGGTTGCATACGATAGGTGGAAGGAATTATCGTGGGGTATTCGTCCTACGGGGCTTTTGATGGCGAAGTTATTGTGGAAATTGGAGGCCTGATCCC
TGAAACACCATACGAGTTTTACTTTAGGACACTGAATGATGCATCTGCCTGTCCTGGGCTCAGTGACGATACTTCAGACGAAATCCTGTGCTCAACAGGC
GTGGCGAGTTTGCCCCACACGGTCCAGCAAATACAATCAATAGGGGCTACGGGCGGTGGCATTCACGTGGATCTTAAACCCCCGAATGACAGGGGGGGTA
GCCAACAATTGTATTACCAGGTTTATATGAGCTCAATTCGGCAAACACCCACCTGGAAACTTGTGTATAACGATACGGGCACATCCTACtggcagacgca
gctccagAAAATGACGGATTATCTATTCATGGCGTCGTGTATGAACGAAGTTGGCTACTCAAATTATTCGACAATTGCCACTTTAGGAACGACGCTCATA
TCGCCACCTGGACCACCAAACAATTTGACCTTGATAAAAGCAACAGGAGGTATGGTGCAGTTTTCGTGGAATAATCCTGATGATGACGGGGGTAGTTTGA
TCACCTACTACACTGTAAACGCTGGCGCTGTCAACGGCAACCTCGCTCTGGTACAACAGACAACAACGACGGAAATCATTTTTGGGGGGCTTTTGGCAAA
CACAGAATACGAATTTGATGTGTATGCCGTGAACAGTTTGGGGACTGGGTCGGACTCTGGGGTGAAAAGTTTCTCAACCACAACAACCACTCCTCCGTCA
CTACCAGGAGTACAGACTGTCTTACTACTGTCTGGAGGGTCCGCTACGATATCCGTTCAAATTCCAACAGACACTGGAGGTGTCGAAGTTGATGATCTGG
TGTGGATCGTGTTCGCAAACGGAGTGAAAATCCCGGCAGATTCCGTTCGGCGTTTGTTGGCTGCACCCCCGCCAGCCTCCACCGCGCGCCGTCTAACCTC
AAGGCGGCTCGCCTCAGACGGCGGAAGTTTAATCTACCTTCAAGCAGGTGGCTTACTACCGTCCTCAACTTACTCGTTTACGATTCAAGCATCAAACACC
GTTGGTGGGAGTGGAATTACCAACGAAACAACAAGTACGACGACAGTGGCTACTGTCCCAGGTGCGCCCGATCCACCAACAACGACGGCCATCACTGGAG
GTGCAATTGGACTATCATGGACTGACCCAGTTGACACGGGTGGAGTCCCATTAACCTCGTACCGACTAAGTATGACAAGCCAAGGTGAGGAAGTGGGGAG
TTGCCAGGGGATGATTCTTTCGTGCACTATTGGGAGTTTGTTCTCCATTACTGGTTACGGAGTAACTCTCGTTGCATACAACCCCGTGGGTGCATCTCCG
AATAGTACGCTTGTTACGTTCACGACGACGAATACTACACTTCCACGAGCACCCCAAGGTGTCCACATTGCGGAAATATCGAATACGTACGTCACCATGC
ACTGGTCTCCGTGCATCGACTTTGGGGGCGGCTACGTCGAAACCTACTGGATCAGTATTAAACAAGCGTCGAACGCTATCATtaccttctccagcagcat
acCCGTTGCTCAGGAGAACGCCACCATTTTCGGTTTAACCCCTGTGACTGATTATACCGCGACGGTTGTATGTACTACTACGAATTTTTGTCCGTTTTAA
CAGCAGTTTGTCTAACTCTTTGATCTTGTTGTCAACAGCGTGCAGTCACAGGTGATGGCCAACTCGGAGATGAGAGCAAGACTATCTTTTTCACGACACC
ACGTTATCCTAATCAGCCTCGACCACCCGCAGTTGGTTGCCGTAAGTACTTTGTACGTTGGATTTTGAGGATTGGGACCACCACGTAACCTTTCGTTTTT
ACTTTTTGTTGTCGAAGATTCACGCCAAGTGGCAATCGTTTTCTGGGAGGCTGAAGACGATGCGGTCAGTTATCTTCTTTATCGGGATGGTGCGCTATAC
CGTGACAATGGTGATGACGTCACATTCGAGGATCCAATTGTACTTGGTACAACGTACACCTATGAACTACAAGTGAAGAGGTCAGATGGCTCTATCAGCG
CCCTCAGTGATGCAACGACGTTTGTTGCCACAGTTCCCGTGACTAGTGGTTTTGACTGCGAAGGTGTTAGAGGATATATCCACTGGCACGACTACAAGGA
CCTGGATCATGAAACTTGGACGATCATACCACAGAACCAAACTGGCATATCAATCAATGTAAGTGTGGACAAATTATTAGCTGGATATTGGATATGTGAA
AATTAACGGTATTTTGTATGTTTTAGATCTCCATGTTTTGGCTCGAATGCGATCACGACAGTTTGACTATCAACGTGACAGCAAACGGAACTTCAAAACA
ACTCTGGAAAGGAGGCTGTCACCGCGATGGGGACTTTGTCGTGTCAACTGCAGCTGGTGTTGATAGCGTTGTACTTTTGTTCTCATCTGATGAGAGCGTG
ACGTATGAAGGGATGGCGATATACTACGAATCTGTCGATCCGATAGATGCAGTAGAATCTGTTTCCACACCATGCCCTCTCTCGACTACCGGGTTTTGCT
CAATGAATGGGGCTTGCCGAAAGGGTTCGTGCTCGTGCTTCAGTGGATATGTGGGGGAGAGCTGTACCAATGCGGTGATCTGCCCTCAGGACACGTCAAC
CTGTACAGTAACGACATGTGACCCAGTGTGCTTAGAATCTCAGAATGACGTGATCGTGGTCAGTGTAAATGGAGACGACACTCAAGGCACGGGGCAGCGT
ATGGATACGTCTGCGACCGGAACAGATCCTAAAGCGGTGAAGTCGCTTAGACGAGCCCTACAACTCGCAATGTCGAACCAAACAATTTTACTTTATCCTG
GCACCTACAGTGGGATTGACAATTGCGGTTTGACTATGGGAATCGGTAGCCTACTCgttcgaggacttcgagGGCACATCGTAACTACACTGGATTGTGG
ATCCTTGCTAAATGGTGTGGTTATCACTGGCGTGTCTGTTCGCCTGGTTGGATTGACAATACAAAATACTGTTACGAGTACTGATGGGGCTGCAATTAGC
GCTTCGACTGCAATGGTTCAAATGGAGGACTTATTGATCACTAATGGAGCTTCTCGCCAAAGTGGAGGTGCAATTTATGCGTACCAATCCCAACTGACTC
TTACGAGCTCGAACATAGCGTTCTGCACCGCCGTCACGAAAGGAGGTGCTGTGATGTTGGATGGATCTACTATGGTTCTCAATAGTTCAATTATCACGTT
GTCCACGGCTGCGGAAGGAGGCGGGATATATGCACAAGACACTGTGAGTGTGAACGGTGATGACGAAAGCAAGATTTGGAATAACACAGCCACCGTAAAT
GGCGGCGGACTCTGCGTAGGTGGAACATTCAATGGCGTAAACTTGAACCTTTTGCAGAATATGGCGTCCGTGGGAGCTGGCATGGCAGCAACTAGTGGAA
ACTCAGCACTTTCGCGAGTGATTATAGCTGGGAATTACGCAATAAATGACGGTGGAGGTGTCGCGCTGCTCAACGTAGCAAATCTGATTTTACAGAACTC
CCCGATACGTGGGAACCTTGCAGAACGCAACGGCGGTGGAGTTTATATGGAATCAAACGGAACCATTGAGAGTAGTGTGGATTCTGAGATTTACAACTGC
TCGGCAGGTACGCGGATAAATTGGAAAAGGGTTAACTTATGGCTGAGCTCGTTATGCTAACGATATCGTGCTACTTGCTTTGATGTTAGCTTCTGGTGGA
GGGTTCTACTCTGGGGAATGGACTCAACCGACAGTAAACAGCCTCATTGTTCGTTTCTCCTCAGCAACGATGTCAGGAGGTTGCGCTGCATTTTCAGGTA
GTTCAGCGAGTTTGAGCAACGCAAAATTTGTGGGATGCAATGCACCTACAGGAGGTGGCATGTATGCAGGTACCATGAGTAAAATTTATGTGCTGTACGC
CTCCGTTGAAAGGtgttcagcagcaaatggagcTGGGATGCACATCGATTCGAGCTCAGTTGTGGGAGCAGACGATGGTTCTAACTCCGTTGTACGAGAC
AGTGAGGCTGACACTGCGGCTGGAGGTGTATTTATTACTGGAAGTCAAAGCTCAATCCAGTTTTTCAATGTGCAGAATTGTTCAGCATCTTTTGGAGGTG
GCATCGCTGCACAAAATGCCTCATTCGTTACGATGAATTCTATCGACATTTTTAACAGCAGCGCAACTCAAAATGGTGGTGGATTATATGCTCAGTCTTC
GACAATCACGGTGATAAATGTTACAACAACGGACAATACAGcgattggtggtggtggagtgTACGTTATCGATTCAAGTATGTCGGGCTCAATTTCGGTA
AGCGGGAATAATGGTGCCCAAGGTGGTGGAATTGCCACATCTGGTGTTAGCACAGTGGAAGGAGCTATTATCACCTCGAATACGGCCGCGCAGagaggtg
gtggtgtgtcGGTGGAGACTGGGGTTTTGACGTTAAAGTCTACAACTATCCAGTCGTGTTCCGCTCCCCAGAGTCTCGGTGGGGGCATTTCGATCATGAG
CGCTGATGTTAAGCATTATGCATTGATTGTTCAGAACTGCACATCGGTCCGTGGCGGAGGGATATATGCGAATGCGTCGGCTTTCAACCAATATCCAAAG
GAGGAGAGCACTGGCATGAGCGAGTATGCAGCATTCTTGGCACATAACAGTGCAGACGAGTACGGTGGAAGCATTTTCATTGACGGAGAAGGAACGAATG
TCAGCGATATTGTTATAACGGATAGCAGCGCCCAGTTTGGAGGTGGACTAGCTGTTTTGGACGCCCAAGCGTGTGCCATCGTGAATGCAGATATTTCGTT
CTCGAATGCTAAAAATTCCGGAGGTGGTTTGTTCTTCGGACCTGGCGTTGATTGTACATTCCGAGATTCCTCGGTGACCTACAACTCAGCAGAGCAATCA
GGCGGCGGTCTCATGGTCCAAGAGGCTACGTTGTATCACTCAAATCTGGAAATATCTACCAATGCGGCAAATACTGCAGGTGGAGTGCATCTGAATAGTT
CTGAGCTACCAGCAAGCTTTTACTCGTGGGACGACGTTAGTTCACAGAGATCACTTATCGACACTAACACTCTCGATCATATTAACGGCAGTGGAGCAAA
CGTCCTTTTCACCTGCGCCAATAACTGTACTTTGTCAAGCTCGGTCATTGCTGGTGGTAACCTGACCTTGGGGAAAGGCGCCGGGGTGTTCATTTTGGGT
CGTGGGAACGCTACAATTTCAGATTCTCTCATTATTAACAACACAGCTCTGATAGGGGGTGGTATTGCAATTAGTGATGCTGAGATAACGAACCTGGAAA
ATGTGGCTGTTGTGGGGAATGTTGCAAATGATACTGGTGGTGGTTTATGGGCCGAAAGGGTAGTGTTCTACCCAAATATATACATGACCAGTTGCGTTTT
CTACAATAACTCAGCAAACAATTCGGGCGGGGCAATATCATTCTTCGGTGATGTTTATACGTATAGCACCTTATTGCTGGTGGTAGAGAATCACGCTGGT
AATAGCGACtctggaagtggtggcggaTTCTACGCCGAGAATGGAGCTCAAGTGGAGGGCGACACCTGGTTGTTCTTATCGAATGACGCCACACTCGGAG
GGTCCATGGCTGCAGTAAAAGGTTCTGGCCAAGCAGGCTCTACCATTAGTATCGAAACGTCTTCGATCACTCGCGACACTACCAGGTTTTTCACGAAGTC
GTGGCAAGATCAATTCCAGAATCTGGTGGGGTTCGAGTATGTTGCAGGCCTCGCCCAACACAAGGTGGCGGTACAAAAGGGTGATCTCGTCTATCTCTCG
GACGCAGATTCCATTTTTGAGTTATTGTCATCGTTCGCGACATCCGGGTCAGCTGATGCCGGAGGAGGGTTTTATGTCAACGCTAATGCGGTTTTCTATA
GCCAGTACTCGGAAATTAGCTCCAACAGCGCAAATGAACGAGGGGGCAGCGTGTGCGTGTCGAACGGCGCGCAAGGGTATTTCATCTCTATAAAAGTGAC
AAATAGCGGTACGTTGTATGCATGCCTACGAATACTTTTTACAGCGCTAATTGGTTTTCACATGTTTGTGTCAAGTGTCCAAAACGGATGGGGGTGGGAT
CTATGTGGACACGTCTTCTAGAGTTTACTTTGAGAGCTCCGATATATCCGATAATTTTGCGGATGACTTCGGAGGGGCCATTTATCTCGATACTGGGGAT
AAAAACACGGTCATCCTAAATATGACATCGGTGGAGCGCAATATCGCTAATGGGGAAGGGTGCGGTAAGAAGTTCTGCCAACTTGTTTGCTTCTTTACGG
AAAACTAGGTCTGCTCACAAATTGCTTTTGTGTGCTGTGACCGTCACCAGGTGTCTTTGTTGGTCGCGAGGCTGTTTTAGCTGGCTACAAATCTCTGTTT
GTCGGAAACGGTGGCGTCACCTCAAGCGGCAAAAGCGAAGGCGGGGGTGCAATTTCTGCAGTTGATGGTGTTGTGAAGCTCTCGAATTGTACATTAGCCA
ACAACACTGCACTAGTGGGAGGAGCAATCCATGTTGATCGCGGCGGGTCGGCAACCATCACGAGTTCGGTGTTCACGGGAAATACTGCAGATCAAAGTGG
AGGAGCGATTGAGATAGACGCAATGGCCAGTGTGACGATCGCTCTACATACTTCCTTTGAAAACAATGTGGCGGTTCTTGGAGGCGCCCTTACTGCTACT
GGCACATCTACTACCACACTCAAATCGGTGATGTTTCATCGCAACCAAGCCAATGAAAACGGTGGAGCTCTTTTTGTTACGGATCAAGCGAAGCTTACGT
TAACAACGGGGGAATTGACCAACAACAGCGCCCAGCTCGGAGGTGGTCTGCATAAGGACGAGCAGGCTACTGTTACAATCGCGAGTTCCAGCTTTATTGG
CAACGCGGCCTTCATTCGCGGAGGTGCATTTTACTATGAATCCATAGTGAATACCACAACTTCTGGAATCGCGTGCAAAGAGAACACAGCTCCAAGTGGA
GGGTGCATGTTTTGGATATCAAACAGTGAAAATCTCACAGCTGTGCAGCCGTGCACGTCTTGCACAATGGAATCGAACACAGTGTACGACATCGCAACTA
ATACACGAGACGTCCAGATAATGTGGTGGCCAGACAATGTCACAAGTGGTGTGGAAATTCTCGAACCTGCAGACGAAGAGTCGATCGATGTGATTGAAAA
TCGGAACGTCACACTGGACGAGACGAGTTATGTTTGGCCTCGACTAAAGGCTGTCGATCTCTACGGACAAATTGAAGTATTGGACAACCAGACGGCATGT
TCTGTGAGCGATGGACTCTGCACTGAACAAACAGAGACGCTGCGGTTTATGCCTAACTTTGAAATTCGTGCAGCCATTGGGGTTCTTTCCTTTCGTCAAG
CTTCATTCACTGCCGCTAACAGGACACCAGAAGAAGGAGTTTACACGGTAAACGTCTCGTGTAAACTGCCTGGATCCGAACCTCGAGGTTTTGTCCAGAA
TGTGACGTTGTTGCCTTGCCAACCTGGCTTCTCTGTTAACCAGGGGTACGTGTgcaaccccccccccccccccccaatGTGCGTTCTTTTTTCTTACCAA
TTTTGTGTTTCCAGTGTCTGCCAACGCTGCCAAGCACTAACGTACAGGTATTCAATTGCGCTTTAAGTAGTTTGGTGGCCAAACTGTGGCTAACTTCACA
CTGTGTGCTGTAGTTTGGATGGTACAAAATGCTTTGACTGTCCGTCTGGTGCCCAGTGCAATATGTTAGTACGACGCGCGACGGAAATGATGGCACAGGA
ACTCGGTACCAAATCTCCACGCACACAGGAAGGGTATTATTTGTTCACTGCTCCCGCTTCAAAACAAGAGTCGAGTTGTCTCAAACCTTCGCTGTGGAAA
AATGAGGATCCatgcaagaagctggctCTGCAAAACCCAAGTGCCAATCTTTCCGATGTGATCACCGAATGCTCAAACCTCCCTGGATTCAAGGTTTATT
GGGGCCCCGATCGTCTTTTCCCGTGCTTGTCGGGGAAAAGTTTCTACACATGCGACGTACGTTGTGCTGTTTGAAGTTTTGGAGATAGTACCTCATTTGA
TAATACGTTGTGTGATCAGGTGGAGGGGGCATGTAAGGCTAATGTTTCAATGGAAACATTGGCACTTGCAGCTACAATAACTGATGCTTCATGTGCCGGT
GGGTACGACCTTGCAATCTGCTCGGTGTGCGCCGCTGGATTCAAACGAGCCAGCGATAATTCGTGTCTACGTAAGTACCATCCGCTTGTGTGCCGGTGAT
AATATTCGAGCAAACTAACTTACTCGTTGCATGATGTTTATTTCGTGAACGTAGCGTGTGAGAAGGTGAATGCACAAGTTCGAGCTTCGATTCGATGGCA
AAACTTCGTCATTCCTGGGCTTATGGTCATTACCCTTATCGGTGGTATTTACGGACTGCGAATCTACCTCCGAGACATGACGGAAATTGGTCTCCTTGAA
AAAGCGGAGGCCGATAGACGGCTGAAACCTCCTCAAGCCAAAGATTCTCCCAAAATGGCTGCACGCATTACTCGACGCTTGAGTGCGACGATCACGACAA
TTCGAAGACAATCTTTGGCTGCCACGGAGGCTGCCACAGAGGAAGTGGATACGTTCCAAACTAAAATCACTAACGTTTTGGAGAGACTTTGGTATGGAAA
CCAGAAAAGCGTTTTTGGGATTGATCCTCCCCCGAGGGTATTCCCGGTGAGTCCAAGCAAGTTCAAGATCTTTGTTGGCTTCTTCCAAATATTTGGAAAC
TTCCAAAGCTCCTTCGTCGTGAAGTGGTCAACCAATATCCAAAATGTCATGAATTTCTCTCAGAAATTCAATCTGGTACGGAAACCAATCGATGCCTGCT
TTACTACCGCTAACATTCATTGGTGTGTCTAGGACTTCGTCGCTATTGCTGGAATCGACTGTGTAATCACGAAAAACTTTTATTTCGATTTCACGTACGT
CGGCTTTTTTTCTGCTTTAGTATGGAGTCAGCTTCAGGTTTATCTGAATGTCTTTAACCATGTGCTTGCATCAAGTGTCACCGTGGGTCTGGTGGTACTT
GCCCTCGCAGTTATCACCGCGTACTTCTACGCAGGAATGCGTAGCTATCGCGCAAAACTGCGGTTAATCCCACGAAATTGTCTCCGCTGCGGACTCCCAG
TGCTCGAAGGTGAGGTGATTCAAAATGATGACGAAAGTTTCAACCCTCTTCGACTACTGCGGGGTTGGTGGAGATCGCGCAACCTCTATAAGAATGTTGT
GTCCGGTAACTCGGTGGAAGAAAGTTTTAACCCTCTTCAACTGCTGCGAAATTGGTGGAGACGAAATAATTCCAATACGGATACCCGATCTGCTAGTCcg
aaggaagaagatgaagagtaCAAAGCTCGTTCCATGCTCAAGGAAACTCGTGAAATGAAGCGCAAGTTTGGGATGTCCCAGGTCCGCACACCGTATCTGG
GATTGTTTCGATCACAGCATACCCAATGTCCTATTAGGCGGCATGTTCTTTCTGGAAAGCTGCTTGAACGAACAATTCGCAGCAATCTTCGCGTGTGGCA
AGCGCGAGTCAAGCTGCGCATGAACTATCTGACGTACCGAAACAAATGTCTTAAGCTGTACTGCTGGATGGCTCTGTTCCTGTACCCATCTGTCTCCAAG
ACAATACTAACAGTTTACAATTGTCAAGAGGTTGGCGACATCTATTATCTCATTGCGGATCGGCGTCTGGTATGCTACAATGGCGAATGGGCTGTGTTTG
GGATGGTCGCTACGATCGGTGTGGTTGTGTGGGTGGTGGGGATTCCTTTCTTTTTCGGTCTCCTTATCTGGTTAGCACAAGGTCGTGGTGTAGACGCCCG
TGTAAGGTTATTGCGAAAAGCCCATATGCGCGTACAACTGCTGAAATGGCTTAAAGAAGTGAAGGAACGGCACATTGAGGAGAAGCGAATTGTTTGTGAT
ATGGACAACATCGACGTGCAGAACGAGGAGCTAGCGAAGTACATGAAGTGCAGGAATTTGACGGTATGTTATTGCAACTCTTCAACATTGTTGATTTGTT
TGTAGACTAATAGTATGATTCGAATGCAGGACTCCACGGTTCAGGCTCGGCTAGGCTTTATCTACGCCGAATGTAGGTGATGACTAAAGCTCTCGCTAGC
GATTCGAAACTAACCATTTGTTTTCCGTTCGTAGATAAAGACGAATACTGGTGGTTTGAAGTTGTGGATCTTTCTCGAAAGCTCTTCCTAAGCGCGGTGA
TAGTATTTGTTCAGACCGGAAGTGGTGTCGAGCAAGTGCTACTTGCTCTCGCTGTGTGGTGAGTTTCTTCTAAATTGGACTTGTTTGATCTTCGTTTTGG
CTGATCAACTCATTAATTGCTATTGTTTTCACTGGATTCAGCTTGGGGACCATGTGGTTCCTGCTGTATTTCCAGCCATACGACAACTACACAGACAATC
TCATCGCGAGTATAacacagctgcagctttaTTTCACGTTGTGGCTTGGGGTCATGATCCAACTAAACAACCTCAACGCTGAGTCGCAGATCAACGTGCA
GCTACTGAGCTTCCTGCTTGTAGGATCGTGCATTGTTGTCACGGTGTTTGGGTTTAGCGCGACCGTCAGTGAAGGAATTGCGGAATCACGGAGAATATAC
GCAGAAGCATCCGTCCTGCGCAACGAAAAAGTaaaggctgcagctcgaaaaATGTGGTTCAGGGCATTCAACTACGCTGCCTATAAGAGACAGATGGAGC
TCAACGACAACCAGTTCAGCTTTCGTGATTTCAGCGTGTCCGCCGTACTAGGAGCTTTTCgcaagttggtggtggaagaaaAAATGTTTGCAGATGCCGC
TGCCGAGGTGGATGACCAACCAACGCGAGCACGCCTTTTTTCATGACTATAGCAACAGGGTAAGGACTATCCTATGGAGACCGAGGACCTGTGGAGAATA
GCTAGAACTACGCTTGAGATCCAAACTCTCTATAAGCACAAACCTGTGATACATAGAAAATAGTGTAGTCTTGGTTACCCTGGTTGGTCTACTGCTTTGC
AAGGTGGTGGTCACCCACAGTTTAGCTATAACTTCATAAAATAGGAACCGACTCGTGGAATTCAACGCCGTGAGTTTGGCTGATCAGATGATGAGCCGCC
TCCCATCCCGTAATTGCATATCTGGCATTCCTGTGTCCTCCAGTGGTACGCCCCGTTGATAACATCAAAGCCAACAGCAAACTCGGCGCAATACCGATCG
TACACCGCTTCCCACTCGCCGAACGTTACGATTTCGTACTGGCGGGCAGGAGTCGAGCCAAGGCTGCAACAATTCACCACGAAAAAGCCAAGTTAACTTC
ATAAGCACTAAACCACATATCCAACAGAGACAAGTTACGCTTGCGTGGCCTTGAGTGACTGCTCCAGCGAGAACCCCATCAAGAACATCGAAATATACGG
CGGCACAATAGTCCTCTGGTGTGATAGACACACCAATTCAGCATTTAACACCGGTCCGGGAGCATCGTTTCCTTGACTGCGCACAAACTTCCTCCACTTG
TTGAGCCATTTCTTTGGCACCAAGAAGTACGTCGCGTACTTGCTCCTCCCATTCACCGACAAATGCGgcgccagttgctgctgtctgctgcCCACCGAGT
CCACGGGCGAGAATAATCCCTTCGGGTACCCATTTTTTCTCTGCAAtaactccagcagctcttcggACCCTGCAATTTCGCCGTCAAACCTCGCCCTCTT
tttctcctcgatctccagctcccgtgcctcctgctccagcacacACATGGGGCAGTCACAGCAGGATCTGAGATTGAACCCCGTCAACTCTGGGGCATAC
ACTGAGATCTCCCTGAAGACTTCTCCACTGATGATGGCGCGTCGATTTCTCCCCACACACTGCACAGCCGGGAGTAGTGCGCCATGGGAGCACACGATCA
GCGCGCCGGCCTCTGTGAGCGACGAATTAGCGGCAATTTTAAGCTTCTCTTGTGCCACTACCACGTCCTTCTTTTTAGCAGCATTTTGGCGTCTCTGCTG
CCGTTTCGAGCGTCGGAATTGCTGTAAAAACTGCTCAAACGCTTGGCAGCGCTTCTTGTACGCCCCAAGCCACGCACGActcacgacgacgcagctggGC
GAACACTCGGCGGCGCTTTCGTAGGAGTGAGTGGAAGAACGGGACAGAAGCTCCTTGATGCGAAGCAACTCGGCACCGCGCAAGACGGCGAGCGAGCGGG
GCCAGTGGTCGGAGGCGGAAGGCAGGAAGCTCGTGACGTCGCCGAAGTGGCGGGTGATGACGCGCTCCAAGGCCAGTTGGACGGAGTGAGTGGGTACAGA
GAGAGCTCGGCAGGTAGAGGTGAGCTGGAGCACGTCCTTGGCCGAgagcaaggagaagaggTGCGCGAGCAGACCGTCCGGCAGGTGGTCCAT