Description :
From Genome Similarity Track
Location :
Scaffold_6:19435- 23661
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_6-snap-gene-0.33Calmodulin-binding transcription activator
Pytap_DAOMBR444maker-pag1_scaffold_6-fgenesh-gene-0.17Conserved gene of unknown function

Sequence
4226 bases(100 bases per row)
GCGCGCGCGAGAGAGCTGCGGCTCTGTGCCACGCGGCGCTGGCTCGTCAAGGACGAGCTCGTCTTTCTGCTTCTGCACCACCGGCAGCAGACGGCTGTGC
CGTGTTACCACACGCTGCAGCCGCGTCCGCAGAGTACGTTCCACTAACGGGGAACACGCATGCACCTACGTTGTTGCTGACCCTCTTGGCGTCCGTGACA
GGTGGTGCGCTCATGTTTTACGATGTGAATGATGTCCCGGATTtCAAGAAGGACGGCTGGCGGTGGCAGAAACGCAAGGACAACTCGGGTCGCGTGCGTC
ATGAGATGCTGTCGATAGGGCAGGAAGCGAATCAGATGGACTGACTGTGGAGGTGCTGCAACAGGTACGAGAGGACCGCGCCAAGCTCGTCGTCAATCGA
GAAGTCATCATTCtCGGGACgTACGTTCACTCCGCTGAGGTGCCGGTgCGTCGATATGAAGCTCAGTGTTGTAGTATTTCCtcATGTTCTGACATGTTCG
TGTGTATGAAGACGTTCCACcGACGCAGCTACTACCTACGCGACTCGAATCAGCACGTGATGCTGGTGCACTACTTtGACGAAaCCcAcAaGACcGACCc
AGCccgaTGGGGCgCTGTtgCCGACAcGaCCaTTGCCGCTTGcTGTAGCTGCGTtGTCAAAaGGCGTGAAGCGAACGCTGTCATCCTCACAGAACGTGCC
ACAGTCTGAGTCGCAGCAACTCGTTCCCcTTCcTTtGAAACTGGATCCCCTCGAATGTTCCAGCGTCTCGATGGATGTCATCATGAGAGGTACGAGGCGC
GTGGTATCCGTCGTTTGTTGGATCGAGGTCTCCTTCTTATCGAGTCAGTGCTTCTGATGTACATCATTCTTTCTGCGTTCAGATTGCTTCCCCATCGAGT
ACACCACCCACATGATCCCCTCTGCTAATGGTGTACATCATCCAGCATCGGAGTCTGGTATGTTTGAGGACCAGACGCCGCCACTCGGAGGTTTCGATGT
CCAGGAGGTGGACACAGAAGCTCTGTTCTCCGATCTGTCGAATCTCCTATCGCCTGTGTCGGCTTCCACTCATGACACTATACCCGGGGGTGGAGCAACC
CCAACGCCACTGGTGCCGATCTCGGACTTTTcACCAGATTGGGATTTCATGAGCGGGGGCGCGAAGCTTCTGCTTTGTCTCGCATCGGCGTTGGTTCTAC
CACACACCATCAACCACACCTCATCTGGAAGCGGAGGTGCGCTGTACGTGCAGTTTGGAGCCAGTGCGCGCGTGCCCGCTGAGCGTCTGTCGGACACTGT
GATACGGTGCGCAGGTATGTCTCCTGACATTAGACGCGTGCGATCTCTCCtACACTAACTAGATCGTCGCCAACAGCCCCTCCGTCAACTACACCAGGAC
CCGTAGACCTCTTTGTGTGTTACAGCTCGTCTCCTTCGAGTGCTGACTGCATCCAGCTTTCGACCATCGGACGCTTCCAGTAcAAAAGTGTGGCGACGTC
ACCATCACTGCCCGCCGCTGACAGTAGCCTGACGATCGAGCTCAATAACCTCACTCCCGTTGGGACTGCTGGTAAACGTGGGCGCTCCCCCGTCACATCC
AGCGCTCGTCGGCATCTCTATCGACGCGACAGTAGTAGTAGTAGCAGTGGCCATAGATCTTCCGACGGCCGACGCTGGAGCAACCCCGATCTCAACTTGT
CGATCTTTGCAGACACTGAGTGTACGTCTCATTGACTCTGTGGCGTTGACTTCATGCATGTGCTAACACCATCGGTGTGATCAGTGGACGAGCGCCAGTG
CAAAATCCGCGTTGTCGAGCGTTTGACCGAGTTTCAAGATGCCATCCGAACCACTTCCACACTAACTCCAAGGCACTCAAACTCAAaCACGTCTCCTTCA
GGTACTGAAGCGgTTGCTCTCCCTGGACCCcGTGCAGACTCAGTTGTGCCTACGACTGGAAAaTCGAGTGTGGGATCCACTGACGATGAAGAAACGACAA
TCCcATGGGATGACGGAACGATCGAGCAGCTCAGCGACCAGGATCTCGAGTCACTTTCTGAACAACTCATCGAAGACGTGGTGCGAAAGCTGGTGACCAT
TGCTCACACAAGCGAGGAGCTACTGGACGAACTCAACTCACTCGACGAGACGGGACTCAGTCTTCTTCACTACGTGAGCTTCTACAACTACGCGCACTTG
ATCCCACTGCTCCTGTCACACGGCGCTCAAGTCAACCAGCAGAGCACCCAAGGCCACACTGCGCTTCACCTTGCTGCTGGATGCGGACACGAAGAAGTCG
TCCAGGAACTGGTCCAATCGGGTGCTGACGTGTTCCTGCTCGACTTTGATGGCCTCGTGGCAGCAGATCGAGCAGAAAAATCAGGACACGTCGAAGTGGC
GCAGCAGCTACGCCAACTCATGGGGGAAAACTGGACGCCGTCAGCGGTGGACGAGGCCGAAATCGCAAGCAACGACCTGTGGGCAGCGACGGCTACTGGG
ATGGAGATCGACGAGGCCACTGCGAGTGAAGACGACTTCCAGTCAATCAGCAGCTCCCAGGAACGACTTGGTAGGACATCTGAAGGCATGAATGGTGAAG
GAGATGTCGATGGAGTCGGAGCCTCGTCATCATCCCGCTCGGCGGTTTATGCGGGTGACAACCAGGAGCACAACCGCAAACTCTTGATGGGCGCGTTCTC
GACCATGAGTCTCCACGaCAAGTGCGCTCTATCGCTCAGCATTTCGCGTGATCTCTCGGCGACTGCCTCGACGGCCATGACAACGTCCAAGCGGCGAGGC
AGCAGTATCAGCGAGGATAGTGTTGCAACATTCATGATGACAGGATCGTCGTCTGCATCGTCGCCCTCAAAAGGCATGGACATGCTCGCAAGTAGCACTG
TTACGAGTGTAACAGGAGGTGAGAGTGAGTCCATCTGCGACTCGGACGTCAAGAGTGTGATCGCCGATGATGAAGAGAACATGAACCGCCTAGAAGCAGC
AATGGAGCTCATGGGGCCGGAAGAACTTCAGTCATTAGAAGAAGAAGCGCGTGTGATCCAGCACAACGTTCGGGCGTGGTTGCTGCGGCGGAACTGCCGA
AACATGCGTGAGACGACCAAACGCCTCCATGAGGCTGCCAAAAGCATCGAGGACCAACAAAAGCAGGAAGCAGAGACCGAGCGAGAGCTTTCGTACCGTC
GAGAAATGTCCGAGCGAGAGCGAGCGGCTGTGACGGTGCAGGCGGCCGCAAGGTCGATGCTCGCTCGCAAGAGTTTTCtCCAGACTCGAAACGTCACGAT
CAAAGTGCAGGCGGCCACACGTGGCGTGCTTTGTCGGAAGAACTTTGCTCGGATGAAGACGCACGCGTTGGCGTCACTGGTGATCCAGCGGAATGTGCGT
GAATGGCTCTCGAAACAGCCTGGAGGCGGTGACAAGTCCATCGACGAGCCGTTTGGCAGTGCGACAGCGTCCCCTTTGCAGACGGTGGACGAGACCAGTG
AACGCGACAGTGAGAATGAGGCtGAGGCGGACGCTGCGCTTGTCCGTGAGCTcACCGCTGCACTGGCGCCGCCGCCGTACTCGACGTAGCCATCACTCAG
TTGTGCCACAGCTTATTTATGCCAAAGAGAGACCGACAGACAGAGAGACAGAAGAGCTAGGAAGAGGCCACGGTCTCTGTGTCGTGTGCATTTCGTTCTC
CATTTCTAACTGCATCGCTGCGCCAGCGCTTACTCTTCGATCTCGCCGTCCTCACCCGAGTATCGGAAGAAGCCCTCAATCGGTGGCGTCCACGTCGCGA
AGCCGCGCTCCTCTGGCCACGCCGCGTCGTCCACCTCGAGAGCCTCCTGCTGCAACTCGACTGGCAGGGCGTTGATGGCGTCCCACTTGAGGTCAATCTT
GGTCTGCAGGTCCTTCATGTAGTGGTTGTGTCGGATCGAGCTCATGACGTTGTAGCGGCGACCGATCTCCTGGAAGCGCTGCTCTTCTTCCTCTGTGAAT
GGCTCGCTGTGTATACAAACACCCATACCATACACGATTCATGCTTATCAGCCACGGCCTCTCCCCGCTTTCCATTCGTTGTTCACGTACGCGTCTGGGT
AGCGACCGCGCACCGTGCGCAGCATGAGCTCGAAGTTGGCGTCCTCACCGCCCTTCTTGCCCTTCTTGGCGGCCTTCTtCTTGGCGGCAAaGCCACGCGT
GGCCGCGAGCACCACCGCCGGCACGC