Description :
From Genome Similarity Track
Location :
Scaffold_621:1943- 3666
Transcript NameFunction/comments
Phymu_g11197conserved hypothetical protein

Sequence
1723 bases(100 bases per row)
GATGCACCTTCGGTTCCCTTTGCCGGCCGGCTACTTCGCCAAGTTCGACTTACTACCGAACGAGGCGCAGAACTACCGGTCGTTGGCCAGCGACATCGTC
CGCGAGACGAAACGGGATCTGGATCACTACGTCAAAGACGGACGCAACCTCATCGACGCGCACACGTGGAAACTCGCCAAGTCCAAGGAGCGACTGCACT
GCTACCGGAAGCGCAGCACGCAGAACTCGGCGCACCAATTGGGACTGTACGGGACCGCCGACTCGTCCGACTCGTTCGGCCAATCGACCCGTTCGAGGCC
GTCAATGAGCGTCACGAGCTCCCGTAGTCGATCGGGACACGACGATATGGGCAACTTGTCGGTGTCCACGCGGTCGtcggacgacggcgagcCCAGTCGC
AAGAGCATTCAACCGACAGTGATCGGCTACGGCATTATGGACGGATCAGTGGACGATTTGGTGTACGGGCTGTACCAGTCGTCGACCGACGAAATGAAGA
CGCTGTCAGCGTTCCTAGGGGACGATTCGCTCATCGACTGCGCTGTACTCAAGACGATTCGACAGACGCGGTCGTCGTACCTGGGACTCAAGTGGAATCT
GTCCCGCACCGTCGGCGGCAaccgcgactgctgcttcatggAGTACGTGGGGGTATCGGAGGACGCGAACGGCCAGCGCTTCGGCTATCACGTGCTGGAG
TCCGTCGTGGTCCGCAACTGTCCGCAGTTCGACGACAACTCGATCGTCCGTACCAACATGTCGTTCTGCTTTATCTTCCGACCGGGGAAGCTGGCGGACC
AGGTGGAAGTGTTCATGGAAGGCGCGTTCGATTCGTCCGCGGATGTACTCACTGCTGGCGGTGTGGGAGACTACAGAAGCTCCATGGACATGCTGTTTAA
CCTTCCTACAGCTCTCGTAGGCGCTGAAGCCAAGAAAATCTCAGCTATGGTCAACAAACAGTCCGGGGCGCTGCGGGGCGCGAGCGGCAAGAACCAGAGC
GGGAATCACTGCTCCATCTGCCGTGCCAAGTCCGGCTTGTTGTCGTCCCATACGAATTGCCAGACGTGCGGCGCCGTCATTTGCAGTAAATGCCGTATCC
GGAAAGTGACGTTCTCGCGTCGAGGGAAGATCAAGGTCTCGTGCTGTAAGATGTGCATGGTCATGGTCAAGGACCAGTCGCCGTTCGCAGgggaacagct
cgagcagcagcccgtgaagaccaagaagaagatctcAAGACACGACAGTCGCAGTaggaacaacagcagcaacgctaGGATGGACACGATCAACGCGTCC
GTGTCGACGATGTCCCTCACGGACTCGgagttctcgtcctcgtaccAGTCGTGGCAGTCGAGTTCCGTGTCTTCGCTTCAGTCCGACCTCGACGACAGTT
TCTACAACTCTAATGGTCCGGGGAACGCGATGGTTCCACTTGAGCGGAAGATGCCGGCTCTGATGGAGGGTGGACCGCCTGCTACGACGTaccagagcga
gcagcaacggcagtacgagcagcaacagttcCAACAGCACCAGTTCCTCGTGCGGCAGCAAATGAAGCAGAACGTGGACCCGAATATCCTCCCGATGCCG
AGCCACCGCCAGCCAACGACGCGCGAAGGGCTGTACAAtcagatgctggagctgcagatgcaggccGAGCGGGCGTACAACTTGACCAACCAGAACGCCA
ACATGATGAACTCGGGCCGATAG