Description :
From Genome Similarity Track
Location :
Scaffold_79:194266- 196235
Transcript NameFunction/comments
g8605.t1hypothetical protein

Sequence
1969 bases(100 bases per row)
TCCCAGACAAGATCCCTGCGGAGCTGCCAGCGGATCGCGGAGTGCGCCACGAGATTGACCTCGTGCCTGGATCGAAGTACTGCGTGACGCGGCAGTGGCC
ACTGCCGCGCGATCAAGTCAAGGCCATCGACGACTTCTTCGAAGGCCGCCGCCAAGCCGGTCACGTCCGTGAGAGCATCTCGCCTCACTCGAGCCCGACC
TTCTGTGTGAAGAAGGCTACTGGCGGGGGGCGCATCGTACACGCCTTTAACAAGTTGAACGATGCCACCATCCCGGCGCAGACACCGATCCCGCGGAAGG
ACATGGTACTGGACTCCATGTCGGGCAGCGTCATTTACAGTGCCATCGACTTGACCGATGGCTTCTATCAGATCCTCATGAGAGAGAGCGATGTACCTCT
CACGGCAGTCAGTACGCCCAGCGGTATGCTCTGGGAGTGGCTCGTGATGCCCCAAGGTCTGAAGAACGCACCAGCCACATTTAATCGCATGGTGTCCCAT
GTGCTACGCCCGCTTCGTGACTTCGCTCCGAGTTACTTCGATGACATTTTTGTGCACAGTCACGCTGAAGTGGGTCTCAGCGCGATCGACGTGCATCTGC
GGCACTTGAGGCAGGTCTTTCAAGTGATGAGAGAGAACAAGCTCTACGCGAATCTCAAGAAGTGTGTCTTCTGCGCGCCGGAAATTCCGGTGCTTGGGTG
CTACGTAAGCAAAAATGGAGTCCGTGCTGACCCGGAAAAAGTGTCGTCTATTTGCTCGTGGCCACCACCATCAAACCCCACTGAGCTGCGTCAGTGGTTG
GGCCTCGCTAACTACTTGCACAAGTATACGAAGGGATATGCTGGCTTGATACAGCCACTGTCGTCGCTGTTGAAGAAAGACGCCACGTGGTCGTGGCGCC
CCGAGCATCAAGTAGCCTTCGACTCGGTGAAGAAGAGCTTGGCCTCGGCGCCAATACTGATGCTCCCAGATGACGCGAAACCGTTTCACGTCGTCTGCGA
CGCTAGCGACTTTGCTATCGGGTGCGCGCTCATGCAGTTTGACAACGAAGGCCGCGAACGAGTCGTGAGCTATCAATCACGACAGATGAAGCCGGCCGAA
CGCAACTATCCCGTCCACGACAAGGAACTTCTTGCGATGCGATACGCTCTGATCAAATTCAGAGTGTACCTGCTCGGAGAACAGACGTTCGCGGTGTACA
CGGATCACGCATCGCTGCGCACAGCGATGAAGTCTCCACATCTGTCTCAACGCATGGCACGATGGCTGTCGTTCTTCGCTGAGTACAACTTCGTCGTGCA
CTACAAGCCCGGCAAGAACAATATCCTCGCCGATGCTCTGTCTCGGCGTCCAGACTATGATCCACGAGCGACACGGGGTCGTCAAGTGATTGACGAAGAC
GAGGATGACGAAGATCACTGCGCGATGTGCTTGACATCAGGTGTCAACCTGATGAACGTGACCCCAGAAATGTCGCTACGCGAAGAAATCGCCGTTGCGT
ACAACGACGACGCGGTATATGCCGCCATCCTCGCACATCTTCTTTCCCCCAGTGATAAAACACTCCGCGCGCTGCCGAATAACACGCGCAATCAGATTAA
CCGATATCAACTCGACGGCGATCTGCTGACGTACAGCATCGATCGATTCGATGCTCCCCGCATCGCCATCCCGAACGACGATGATCTGCGCGCTCGGATC
ATCCACGAGTTCCACGACAGCCCTGTCGGTGGTCACTTGGGCCGCGAAAAGACGTTCGCGGCAGTATCCCGCGACTTCTACTGGCCCCACATGTACAAAT
GGGTGCGCAAGTGGGTCCGTACTTGTGAGATTTGCCAGCGCGTGAAGCCGTCAAAGTCGTCGCAGGCTCCCCTGCGACCCCTGCCGATTGCAACTGAGGC
GTGGCGCTCAGTGTCGATGGACTTCATCTTCGGGCTTCCACCCGATGCCGACGGACGGACTGGCGTCTT