Description :
From Genome Similarity Track
Location :
contig_53:194196- 195831
Transcript NameFunction/comments
g10800.t1POM61813.1 ABC Superfamily [Phytophthora palmivora var. palmivora

Sequence
1635 bases(100 bases per row)
ATCCTCAACAACGTTTGGGGTCGATCGGGACCTGGCGAGCTGACGGCCATCCTTGGACCATCGGGAGCCGGTAAGACGACGCTGCTGGATATGCTCGCGG
ACCGAGTGCCGTCGGGAGGCTCGGGCGTGCACCTTGAGGGTCTCGTGGAAGTAAACGGACAACCCCGCGACCTGCGGACTTTCCACTCCATCATGAACTA
CGTGTCCGAAGACATGGCGTTCCTCGGAGCATTCACGGTGTTGGAGACCCTGCAGATCGGCGCCGGTTTGAGTCTGCCCGGCCACATGCCCCCCGTGCAG
CGTGAGGCTCGTGTTCAGGATGTGATCGACGCTATGGGACTGCGGACGTGCGCCAACGCCCGCGTGGGTGACGTCTTCCACAAGGGAATTTCGTCTGGCC
AGCGCAAGCGTCTTGGTATCGCTCTGGAGCTGCTTTCGGACCCTGCTCTTCTTCTCCTGGACGAGCCTACGTCGGGGCTGGATTCGTCTTCTGCTCGTGG
CGTCATGCAGTACATCGAGCGGTTGTGCCAGGAAGGCGGCAAGAACGTCGTGTGCACTATCCACCAGCCTTCGTCGTCCATCTACGGCATGCTCACGAAC
TTGGTCATCCTGAGTAGCGGTGAGCTCGTGTACAGCGGACCCACCAACGCTGCGATTGCCCACTTCTTCTCCATGGGCTACGTGTGTCCGATGTACACGA
ACCCTGCTGAATACTTCGTCCACTTGGTGAACACCAACTTCCACGAAGGCCTCAAACTCGAGCCGTTCGTCCGAGCGCTGAAAGAAGGCACCGAGCCGCA
GCGTCTCCGTGCTGATGTTGTGCGAGACCGCGCTCGCCGGGATCACCTGGCAAACCCGGAGCTGCTGAAGGCCATGCGGCCGTGGCCTATGGACCAGTTC
TTCGTGCTCGTCAAGCGTAACATGACCAACAACTGGCGGCATCCCGGTGTCTTCTGGCTGCGCGTGATGATGTACGTGCTGCTGTCGCTGATGGTGGGAA
CCATGTACCTGAGCTCGAACAAGGACATCAAGGATATCTCCATCGTGCCGCTGCTCTTCTACGTGCAAGCTTTCCTCGTGTTCATGTCCGTCGCTGCCCT
GCCCGCTCTGCTGGAGCACCGTGCAGTCATGGAGCGTGAAATGCGCTCGTACGCGCTGTCTCTGACGGGCTACACGATGTCGAACCTGCTGGCTTCGCTG
CCAGGTATCCTACTCATCTCGGTACTCGCGTCCGCCATTGTCGTGTTCCTGGCCAACGTCAATTCGTTCGGGATGTTCCTTCTGAACCTGACGCTGTCGC
TGATCGCTGCCGAGTCGTTGATGCATCTGCTTGGTGCTGCGGTGCCACACTACATTATGGGCATCGCACTCGGAGCCGGTCTCTTCGGTATGTTTATGCT
CTGCGAAGGCTTCATGGTGCCGTTCGCAGACATGCCCGTGTACTGGAAGTGGGGCTACTACATCGCCTTCCACACGTACTCGTTCGAGTCGTTCATGTAC
GAGCACTTCTCCCAGGTGAACACGACCGAGTCGTGGGATCTGCTCAAGAGCTACGGCATGGACGATGTGAACGTCATGACGGACATGATTATCCTGGCAT
GCTACTCGGTGGTACTGCAGCTTCTCGTCATTGGG