Description :
From Genome Similarity Track
Location :
Scaffold_2:1941571- 1944839
Sequence
3268 bases(100 bases per row)
CAGGTGCCGTCGGGAAAACCGAGAAGCGCATGCTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGAACGATAAGTTTGACA
TTGTATTGGACATGCCGTGGCTTGCACGGCATGATTCGGTCATCGACTGGGAGATGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGA
TGGCTCTGTTGCCGCTACGCACGCACCGACAGGTGCGCGCGACTCCCCACTCGAGATATGCCGCTGTCCCGGAGTGCCCTGGGCGCGCGCGAACACGCGC
GCAAGAGCAACTAGCGTCGGCGTTGCCGCTGACAGCTAATGAAGGAAATGTGTTGGCCTCGGAGGCTGACACCCGCTTTTCAGCCAATCAAGAAGAGTCT
CCGGCCTCAAGGGGCACGGATGACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGGTCTGGCCAATAATAAGAGCC
AAGGTGACGAAACGCCGTCGCCTCCGGGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGAGGGCTCCGC
CAATAACAGACGTCGAGGTAAGGATGGCGTGTCGGTTCCGGGAGCCGACGCTACAAGCGGTGCGGACGGTTGCAAACGTCCCGCACAGGAAAAACGTGCA
TGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCAGGCGACCAAGCCGGGCTGCACGACGAAGCGCCAGGCGACCAAGCCGGGCTGCACGACGAAGCGC
CAGGCGACCAAGCCGGGCTTGAAGTCGCTCGGCCGCGGGATATACCCGCCGGCGGTATACAAGAACAACACTCGTCCACGGCTGGGCCTGGACGAGGTCA
AGAACCAAGCGGAGCCGGGCTCCGCAAAACAAGAAGATGGCGCATGCGAAGGTCGCTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGAAATGTCT
GCCGGGCAGACGGGGGCCGAGAAGCCGGACGTCGAGACGTTGAACGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCA
AGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGACGCC
GAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGAGCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACTAAGAAGGAGCGCT
TTGAGGAGCAGAGCTGGGACTTGCTGAAGACGAGTCCCTTCTACGAGATTCTACGGGAGCACGCGGACGTGCTTCCGGAAGAGATCCCTGCGGAGCTTCC
GCAGGACAAGGGCATCCAGCACAAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCAAGGCGATCGACGACTTCTTTGAGAGTCGTCG
CAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTACAAC
AAGCTGAACGATGCGACGATACTGGCGCAGACACCGATACCGCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATC
TGCGTGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCC
GCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTC
GTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGA
ACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTCGGGAAGAACGGTGTCCGCCCCGACCCTGAGAAGGTCAGAGTGAT
CAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGACCACGTACTTGTGCAAGTACCTGAAGGACTACGCGGGCATGATA
CCGCCCGCTGACCCAGCTCATGAAGAAGGACGCCGAGCGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCAGGGCTTGACTGAGGCG
CCGATCTTGGCAGTGGCCGACCAAGATCGCCCGTTCCACGTTGTGTGCGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGG
GTCATGATCGTGTTGTCTACTACCAATCGCGTCTGCTGAAGCCAGCTGAGCGCAACTACCCCGTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACT
CGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTCGCTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAA
CGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGAC
CTGACTATGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCAACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGC
GCACGACGCGGACGCGAAACTCTTGCTGGCCTACAGCTCAGCGCCTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGT
TATCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGACCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGT
ACAAGTATCACGATGCACCGACTGCGGGGCATCCGGACCGTGAGAAGGCATATCTTCTTCTCACGCGGGACTTCTACTGGGCCCACCAGTATAAATGGGT
GCGCACGTACGTCCGTGCTTGCGAGGTTTGTCAACGAGTGAAGCCTGCGCCTTTCGCGCAGGCTCATTTGCAGTCACTACCGACTCCGTCGGAGTGTTGG
CAGTCCATGTCTTTGGACTTCGTGTTCGGTCATCCCCCGGACAGCCAGGGGAACACGGGCGTTGTTGT