Description :
From Genome Similarity Track
Location :
Scaffold_58:194122- 196824
Transcript NameFunction/comments
Phyin_T30-4PITG_17492Putative uncharacterized protein
Phyin_T30-4PITG_17493Putative uncharacterized protein

Sequence
2702 bases(100 bases per row)
ATGCACTACAAGCTGACAAAGCAACTTTCGAGGCTGCATCGGATGCTGGGCAAATTCCAGCAGAGAGGGCTTGTCCGTCGATGGCAGCGTTGTGTAGCAC
AGGACCCGACATGCTTCGATATTCTCAATGATTGGTGCCACAGTGATACAGAACGGATCGAGCGAATGGAAGGGCTCTTGCTGTCGAGCCCGTTTTTACT
CCGTCTGGACAACAAGATGGATTACGTTTGGAGGTACATTATTCAATCCATCAAGAAATCTCGAGGTCATTGCCCACTTGGCGTCGAAAACGGGAAATTA
GGCGCTCAGAATCAGTCGCGACAGAAAAAGCTCGCTTTCACCTTTTCGCGCAAAAATGGTTGTTTCTGGAAGCAATTCGTTAGTATGGGTTTGCAGCTAG
AGCCTGAAGATTTTCGGTTGCCGATCATTTTCTCCATCGAACGAGGCAACTCGAGCAACCAAGGTGTCGAGAATCGTGAGGGCAATCTGAAGCTTGTGCT
GGTTCGACTAGCGGCGGGATTGCTCAGGGAAGTACCAGGTTTGCTTGAACGCAGCTCAAGTGACGATTTGGAGAAGACGCCGCTCTCTTCTGACAAGGAG
GAACTGGCAGCGCAATTGCTAGGTTTTTTCATGCTGGGTGAGCTGATTGCACACTTTGTGCTTTATGCAGTCCCTTTAAGTGGAATCCTAGACTTCACTG
CAGCGTTTTTGCGATGTATCGGTTGCAAAGGGAAGTATCGTTTGGCACGTGATAAGGCTTGGGAAAACGCTGGACGCTCATTCGCTGCAGGATTCGAGGC
TGTGCTGCCAGCAACTCTTGATCTCTTTCGCGCCGATGAGCTCCGTGTGCTTTTCAACGGCCCCGATATGAGCCTCAACGCTATGCAGATCGACTGGAAT
ACCGCGGTTAACTGGAACATGAGCGGACACGAAGTAATAGGAGACAAGGAAGTTGGAAGTGCGAAGACGTGGTTGCCTCGCTTAATTAACGAGCTAGTGG
AGGAGGAGCAACAACTTGTACTGCTGTTCATGACGGGCACATTCCAGTTAGTAAACGAGCGCTTTTTTCGGGCTGAAGGGAATTCTGGGCGTATTACGGT
TGAGTCTTTTCTCGAGACCGACGGCATGCTGGACCACGACAAGATGTATCCGTCGATGGAGCACAAGGCAGGTATACTACGACTTCCGTCTTATTCATGC
TACGAAGCTTTCAAGAAAGGGATGCTAGCTGCCATTCGTCATACCAACCAAGCATTTCTTCCGGAATAATGTAAACGGGTTTAAAACTATTGATTCTTGC
TTACCTGGTACTGAAGCCCAAAGAGATAATCCTGCAATAACGTGACTACTGGAATATCAATGAGCTCTGTAAAAAGATCATCGACTTCCTCGCGCGTGCT
CACACACTCCAGCTCATCTGCTCGGAAGCTAAAAAGTGCTGCAGCGAAGATGACGACAATTTCTAGCGAATCGTAGCCAATGACGCGATCCCAGAGGAGG
AGTACTTGATCAATGTCCAATACACCCGAGAACGCACTCTGAATCCACGGGAATGCAACGTCCAGAGGTTTGAGGCCAATGTTTCTGAGATGGAAGACAG
CAGCGGGACTGGAGCGCACAATGAGATCCTCAAATAGCTTGCAAAGTGGTAAGATCGTTCCTCGTTCAGTGCGGATAACATTGAGCTTGCTCCAGTATCG
AATGTACAATTCGCGGAAAACGTAGTAGATCTCTACAGGGTCCGCAAAGAGATATGCTAGTGGAGCCAGATACATCACAAGACCACTGAAAGGTAGCACG
CCGTTCGGGGGAACTCTGCTCTCAGCTTCTTGAGGCCGTAAATTTGCTGTCGTTGGAAGTCCAGCTCCAGACAACGAACATGTCACGGCACCATTAACTT
GCAGTGCTTGAGCCTTGACGTATGTATCCCGAGTGAATGCCATGAGTACGCTTTCGAGGTGGTCTTGGAAAACGAAGTAGTCACAGCTGTTGATTGTCTG
CTGGAGATCAAGCAGATACATGTCGTCCGTGAGGTAGGCCCACTGCGCGACTTGCTGTTGTAATTGTGCGTAGTAGTTTCGATCCAGTGCGGTGATAGGG
ACTGACAGAACTTGCCGCCATATCTGTATCAGGATTTATTGAGTGAACTGGGCTGTTTTGGCATTTTGAATTGTAGAATACCTTACCTGGGGTCGCAAAC
TGACAGGGCATCCTGTCTTGGAGTATTGGCGAGCCATCGACACACTTTGATGAGCTAGAACTAGATCGCCGACACGGATTTTCTCAGCAATGAACGCACC
CCTTTGCGTGGGGAAGAGCTCATCAAGTCCAATTTGACCGAATTCTGGAGCGAGCTCCGAGAATAACCGTCGATACTCGGGGAATGGCGGTGAATAGAGC
TGTAGTTGAATCGAGCCTGCGCCAAAGCCAAACGTCAATTTCTGAGCAATAAAAGCTGAGTGCTGAGTGCGTACCCCAAGTGTCTGCTGACGTCTCCGTC
GACTCGTGAGCTCGGTTGAGCGGCTCGATGGCTTGGAGTGAACGCAGCAGGTCAATTCTAGTGTTTAAGAGCGACAATTACAGCTAAAACGAACCAATCA
GCTTGATATCATGTCATGCCGTACCCGTCGTAGAGAAATCGTGCAGCTTGTATTTTGTTCGGCTTGGGAGATTTCGTGCTCTCACCATCGGTTTGTGCTG
TC