Description :
From Genome Similarity Track
Location :
contig_44:1940- 3783
Transcript NameFunction/comments
g9748.t1hypothetical protein

Sequence
1843 bases(100 bases per row)
TGTGGCGTTGGGTTTTGGTGCCGAACTGTCACGGTCCGGCTGACGTTGCACCTTTCAGTGAACGGCGACAGAGCGTCTTGATTGGCGGGTCTCATTTCCC
GCGCTATAGTGACCTAGGAACAATAGTGACCGAGGTCTCGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAAAAGCCTCGTTTGTACCCATTTCGTATCG
TACCCTCGGCTGTGTAGAGCCGGCTATACGATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCTCAATGATGACCTAC
AGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTC
TTAGGGTCTGGATACGCTCGGCTGCGTTGGATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTG
GCCGAGAGTTAGGGGCGACCAGGAGTGTCGGTCCCTATATATTGGTGGAACCCCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGC
AAACCGTATTAGGCGTGACTGCCGGTACCCTTCCTTCTGAAGGACTGCGGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTA
GTAGTGCAGGTTTTAAGGTTGGCCGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGAT
CCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACATCTGTG
TCTTCGGGGAGTCCCTTCGAGCTCCCCCCTTTGGTCTCCTATCGGTCCTATGCAAATACCTAATGAAATGAAGTCGTTATAGATCTCCCTGCGACTCTTC
GCTCAGCTTCCTAGTTAATCTTCGCCGAGTCGGGTCGTTATGGATCTCGACCGACCCTTCGCTCCGATTCCTGATTTATCCTCTCCCACTTGGAATAACT
CCAAAATGGAATGCGCTCGCTGAGTCGCTGAGTCTTGGTGCTCGCCAAGTCCGACTGCTTCGCCGAGTCCGCCGCTTAGGTGCGAACTTCGATTAGGTAC
GACGTACTTAGCTGAGCCAGACTGGGTGGTCTACCCAAAATATGAGTTTCCCTACACCACAATGTGCTGCGAGTTCATCTCTCGCTACCAAGAAGTGCTC
CGCAATTGTGAGCTGCGCAACCTGGAAGGACCGACCTACGCGTATCCGCGCCAGACGTGTTGATGGTCACTTCAGGACCTCTGCCAAAATTCAAGTAGTC
ACACGTCACAGGGAAAATATGGTGGACACAAATATGGGCAGCAGCAAATTACTTGTGTTCAGTATGCAGATCTAAACGTCGGCGAAAGCTACAACTGAGT
TCTGGTCGAGAGCTACAGGCCCTTGAGTGAGCGCGGACCCAGCTAACTGCGCCCTGCATCTTCTGCCGGATGCCACCGCCTTCTTTTGCTGCGCTGCCAC
TTGGCGCTTCAGTCTCCCCTGCTGCTGCAGCTTGCTGACGTGCTGCTTTTCGCGCAGCAGTTTCCACTTTGCGTGCAGCTCTTGCTGCCGCTGCTTCCTG
TTTCGCTTGATTCTTCGCTTCCGCCGCCGCCACTTTCATCTTGACGGCCGCCTCCATCTCCTTGTATGTCAGCAGCTTGCCCCCAGAGACGTTGGCATCG
ACGAAGTCGCCCTTGGGACGTGGTCTCACTGCGGGCTCGATCA