Description :
From Genome Similarity Track
Location :
contig_44:1940- 3783
Sequence
1843 bases(100 bases per row)
TGTGGCGTTGGGTTTTGGTGCCGAACTGTCACGGTCCGGCTGACGTTGCACCTTTCAGTGAACGGCGACAGAGCGTCTTGATTGGCGGGTCTCATTTCCC
GCGCTATAGTGACCTAGGAACAATAGTGACCGAGGTCTCGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAAAAGCCTCGTTTGTACCCATTTCGTATCG
TACCCTCGGCTGTGTAGAGCCGGCTATACGATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCTCAATGATGACCTAC
AGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTC
TTAGGGTCTGGATACGCTCGGCTGCGTTGGATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTG
GCCGAGAGTTAGGGGCGACCAGGAGTGTCGGTCCCTATATATTGGTGGAACCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAA
ACCGTATTAGGCGTGACTGCCGGTACCCTTCCTTCTGAAGGACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTA
GTGCAGGTTTTAAGGTTGGCCGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCA
ACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACATCTGTGTCT
TCGGGAGTCCCTTCGAGCTCCCCCCTTTGGTCTCCTATCGGTCCTATGCAAATACCTAATGAAATGAAGTCGTTATAGATCTCCCTGCGACTCTTCGCTC
AGCTTCCTAGTTAATCTTCGCCGAGTCGGGTCGTTATGGATCTCGACCGACCCTTCGCTCCGATTCCTGATTTATCCTCTCCCACTTGGAATAACTCCAA
AATGGAATGCGCTCGCTGAGTCGCTGAGTCTTGGTGCTCGCCAAGTCCGACTGCTTCGCCGAGTCCGCCGCTTAGGTGCGAACTTCGATTAGGTACGACG
TACTTAGCTGAGCCAGACTGGGTGGTCTACCCAAAATATGAGTTTCCCTACACCACAATGTGCTGCGAGTTCATCTCTCGCTACCAAGAAGTGCTCCGCA
ATTGTGAGCTGCGCAACCTGGAAGGACCGACCTACGCGTATCCGCGCCAGACGTGTTGATGGTCACTTCAGGACCTCTGCCAAATTCAAGTAGTCACACG
TCACAGGGAAAATATGGTGGACACAAATATGGGCAGCAGCAAATTACTTGTGTTCAGTATGCAGATCTAAACGTCGGCGAAAGCTACAACTGAGTTCTGG
TCGAGAGCTACAGGCCCTTGAGTGAGCGCGGACCCAGCTAACTGCGCCCTGCATCTTCTGCCGGATGCCACCGCCTTCTTTTGCTGCGCTGCACTTGGCG
CTTCAGTCTCCTGCTGCTGCAGCTTGCTGACGTGCTGCTTTTCGCGCAGCAGTTTCCACTTTGCGTGCAGCTCTTGCTGCCGCTGCTTCCTGTTTCGCTT
GATTCTTCGCTTCCGCCGCCGCCACTTTCATCTTGACGGCCGCCTCCATCTCCTTGTATGTCAGCAGCTTGCCCCCAGAGACGTTGGCATCGACGAAGTC
GCCCTTGGGACGTGGTCTCACTGCGGGCTCGATCAGCATAGAG