Description :
From Genome Similarity Track
Location :
Scaffold_2997:194- 2646
Sequence
2452 bases(100 bases per row)
CGTAAGGTTGGGTGCCAAGTGGACGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTATACCGTACAAACGGGAGAACGCGAATCAAGATCA
CGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCCTTGGGATGGATTTCATGGTGCCAGCCGGAGT
GAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATA
AGGGCGGATAAGACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGTCAGACCGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCG
AGAAATGGGTACCTACCGTAATCCAAGGACCAGGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAAGA
GATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAGAGAATGGCAGAATCTGGTGTACGAG
GCGACTACCGAGATCGAATCTCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCC
TGCAGATAGATCGACGGGTTGAGATCCAAGCAATGGAGGTTGGATCCACGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGATGGA
CGAAGGATTGCAGAGGGCTAAAGCCGAACAGCCGGATCCCGCTGATCCACAAGTGGATCCAAGCTTTCCACTGGATAAAGTGCCTGGATCCCTATCGAGA
GTGGCAACGCTAGTCAAACCCGAACCGTCGGGTTTAGACTCGTTAGAGGACCGGCTGGATCCGACAGGTGACTTCCCCAGTACCAGGATACCCGACCCCA
CGAAGACAGAAGGGATGACGGTCGAAGGAGAGTCGCGGTGCCTGGATCCAAGGGTGGATCAGACAAAGACCGAAGATGAACAAGTCTGCTACCGTGAAGG
CGGGGATCTACACGCCGAGGATCTGGGAGAAGGTATGGCGGTAATCCCGGAGGTACCACTGACCACCGAGGAGGTCACGATTGATGATATCCAAGTGGAT
CCAGGGGCGAACGAACCCACTGAAGTGGATCGTCTGCGTCAGAAGATCTGGGAAAGCCGACATCTGCTGATCGGTAAGGGTAATGCGTTACCGCCCGCCG
CCCACGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTGTCAGATCT
TATTAAGGGCTTGCTGCAAGCCAGGATCATCAGCTTCTCAACGTCCCCGTGGGCGTCGCCGGTGGTAATCATCATCAAGAAGAACGAGGTGGATATACGT
CTGTGCATTGATTACCGGCTGGTTAACAGCCTGACTCGATTGATGGTGTATCCAATGCCTCTGATCAATGAGCTGTTGGAAGATTTGGATAAAGCACTCT
GGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGCCTGTTCGA
GTGGACCCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTCATCGATAACGCCCTCTATGGGTTCACCCGAATACCGGAGCCCGAA
ACGGGTGGATCCGGGGAAGGTGACGCAGAAGTGGATCCATTCGAAGCGGGGGAACCAGGGGATCCTGGGACCCCGTCTGTGTTAGGACGCAGATCTTACA
TCGACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTAGAGGCGTGTACTAAGTGGAATCTCTCTATCAGCGT
GGTTAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTGGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGTC
GATTTGTCCTTCCCACAGTCGTTACGAGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAAGATTACGCTTTGTTTGCCGCGG
TGTTGTATGAATTAAGAGAGGTAGATTTTGCTGCGATGACCGCTCCAGCTGTCCGGATGAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGGATCCACG
AAGGGATCCAAGTGGTATGACGTCAGAAGAGGACCTAACACAGGAGCTGGATCCACCCCGAGACCAACAGAGAGAGGATCCAGTCTGGATAGAGACGACG
GATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCAT