Description :
From Genome Similarity Track
Location :
scaffold_544:194- 1370
Sequence
1176 bases(100 bases per row)
CGACCCCTATGGGACCACTTGAAAAAGGATGCTGACTGGGTCTGGGAGCAACAGCATCAAGATGCTTTCGACAGCATCAAGGCGAGCCTACAGCAGGCGC
CAGTCCTGGCTCTGCCTGACAATACGAATTTGTTCAGCGTCGTCTGTGATATGCAATCGGCTACTTGCGATGAAGTACGCTCTTGTCAAGTTCCGAGTGC
ATATCTTGGGCTCGATGACCTTTGTGATCTACACTGATCACGCGTCCTTGCGGACTGCCACCAACTCGCCATACCTCCCACAGAGGATAGGGAGGTGGCT
GTCATACTTTGCAGAATACAACTTCTGCGTCGAATATAAGCCGGGCAAGCTCAATGTGCTTGCTGATGCCTTATCGTGTCAACCCGGCTATGAGCTAGCT
CATATCAGTCGGGTCACGAATGATCTGTACGATCGGATACGCCTGTCGTATCGAGAGGATGAGAACTTCACATCCCTGGTGCCGTTCTTGTCTGAAGACA
AGGACGCCGAGGTTGATAGGCTATCGCCTCGACAGCGGGCGCAGCTCCATTGATATGAGCTGACCGATGGCCTACTCCACTATCGAATAGAGCCAGGAAA
TCGTGACGTCGTTCCGAACGACGAGGGTCTGGGGTACGGTATACTTCTAGAGGCGCAAAATGTGCCGTCTAGTGGCCGTCTGGGCCGAGAGAAGAACTAC
CAGTCGGTCTCTCAATCGTTCTGGTGGCCCATAATGTACAAGTAGGTTGCACAATACGTTAAGAAATGTGAAACATGTCAGCGGGTGAAGCCAGCAGGCA
ACACCTCGGCTTCACTTCAGAGCCTCCCCGTTCCAGCAGATTGCTGGAAGTCGATGCGTCTCGACTTTGACTTTGTCCTTACAGCCGATGACAAGGGCAA
CGGCATTTTGGTCTTTGTGTGCCGTTTGTGCAAGATGAACCATCTTGCTCCGGTACGTGACAACGTCACAGGGAAGCAAGCAACACAGGGGTTCCTCGAC
TTCGTGTTCTGCCATCATGGTCTCTCGGACTCCGATCGAGATCCGTGGTTCAAAGCGTTCTGGGAACACTCTGTTCCGCCTATTAGAAACCCGGTTGCTT
ATGTCAACCGCCGTCCACCCGCAAACGGACAGCCAAACCGAGCGAGTCAATCATATGCTTGAAGACACGCAACGTA