Description :
From Genome Similarity Track
Location :
Scaffold_27:193943- 198693
Transcript NameFunction/comments
Physo_133639eukaryotic translation initiation factor 2 alpha kinase 4 (predicted), isoform CRA_a

Sequence
4750 bases(100 bases per row)
CTTGCGGCTTGATTTCGACGGTGGTGCGAGAGACATCATGTCGTACCGGTCATCCACCATACTGTGCAGGAGAATGTATCGCTCGCGTCCAACGCTGCGT
GAGTTGGCCTCGGGGGTGAGTGCCAGGACCTCCTCCATCGTGTACTTGAGCTGCTTCCGATACCGGGGGTTGTTGGCGCACACCGTGTCGATGCCGGCAC
GACCCTCTTCCATCAGGGCTGACGACATCTCGCGTACCAACGTGAACGGGAGATCCACGGACAGCACCTTCATGGCCTCGTCCCCCCGCGACGAGAAGCT
CGACGAGATCCACTTGGACACGCGACGCGTGACTTTCTGCGTGTCGAACTGATAGTTGCGGTAGTTTCTGTCCCTGGATTGGTACTTCGCATCAACCACC
CTTACGTCGAAGATAGGCTGCAACGTACTGCCAGATGACGAGTTGCCGCCACCACCGCCATTGCTGTTGTTGCCCCCGCTGTCTCCGAAATGGTTGTTGC
CTCGCCCACCACCGGTTGCAGTATCACCATGTGAGTTCTTGCCGAAATTTTCCAACAGCCCGCTGATGTATTCCGGTAGAGCGGTCACGTTCGTCACCAC
ATCGGCTTCGGAATGGCTCTTCACCGCACGGATCTTCACCTGTTGCTTCTCTCGCATCATGTGCTTTTGCACGATCACCATCCAGTGTGCATTTTGCTGT
GCGCAGTAGTCCTCCAGGTCTTCCAGGTGCAGCGGCTCTGGGTGCAGATAGTCAGCTCCGATGCCCTGTCCCCACAACAGCGTTGCGATCTGCATTCGAA
ACAGCATCGTGTCGGACGCCTTGCCTGCTGAGCAAATCAAGACCTTGCGGCCGCCCGTCAGCACCTCTGAGGCCGGGGACTTGAATTCCAGAAGAGTCGG
GCACATGCACTCCGCAAGCAAGGATACGATCTTGTCGATGGCAAAGCGCACACCCATCGCAGCGACTGACGAGGCTTTCGCGTACGCTGTCGTGAGCTTG
AAGCGCGATATCAGTGCATCATAGCGTCCACCCTCCGCGATAATGATCTGGTTGTCCGTCGCAGCGACCAGCAGTGAAGCGGATTTATCGGCGTTATTGC
CACCATACGAGGGTTCATCCAACAAAATAGCCTGGAAGATGAAACCTGACGTGTACCGCTCAGGACGTGGGCTGAGCCCTAAATCCAATCGTGTGCACAC
TGGGCCCGATAGCTGGAGGAATTGCATGCCTTGCAGAAGCAATCGCAAGGACGTGATGCCCTCGTTTACATCCTTGACAATGCGCCGAAGCTGCGCGTCT
CGCTTTTGAATCTGTTTCCGGTCCGCTGAAGAAGACACAGCGCCGGTATCGCCATCCGGCAGTGCGTCGCGGCTCGAAAGAGCCCGATTTTTCGCAAATA
ACTTCTGCACCTCTAGCTCGATCAAATCCAGCGATGTGAGGCAGTCCTCCGGCAATAGGAAAAATGGTTTTAACGCGTCGATGGCGCTTGCTGGTGCGCC
ATAGTGTTTCATTCGCTTCGCGACAAACTTCCAGCGTCCAGGTTTCAGGCTTGGAGCTTGCGTGGACGGCGGACCAGCGTGCACGTAGAAGGAAACTTCA
TTCGAAAGAAGCCGCAGCACCTCACGACGGGCACTGCTTGGAACGCGGCATAGATCAAGAATACCGCGTGTCATCCGGGCGTCGTTGAAGCGTAGATAAT
AAGAGCCCAAACAGCTCGGCAGCGCTTTGATCACTCCAGACACCACCTCTAGGCCTTCCAGCTCCAAGAAACGGAAAGAACCACCATCATCCCAGATAAT
GTCGAAATCTGACTCCGTGAACTCGCGTGGATGGCCGCCACCAACACTCTTCCGGTACACTCGGTCAAATTGAAAGCACTTCAGCCGCGAAACGTTGTGT
CGTGCTACGAAGCGAGCAAGCCTCTCGGTCAGATCAAACGGAAGCGATACTGAAACACCGTTGCCATCCAGCATCATCGATGCGTTGGGTGGCGCATTAA
GAGTGATTCCGTTGAAAGTCTGCTCCGACAATCGCGGCATCAACAGCGGGGTGGACATCTCAACCGCCCCATGGCGCTCAAACACTTTCTGTAAGCAACA
CAAGAAGATACATCCTTCAGACTCACACTAAACACTTCACCTCGGAGCTCTATAAAAGCTCGTACCTGTAAGACGTTCCTGACATACGTTTTCGTGCGCA
ACTGAACCTCGTAGCTGCGCATTTTAACCGACTCCAAGTGATCGTAGGTGTAGTCGACATGGTTAAGAGGCTCTTGGGAGACCAGTGCGTCGATAAGCTG
TCCGAAAAACTTACCCTGTGGGTTTGCTAGGGTATCCAGCGCCTCACGAAGGTAAGAACCCTCTACTTCGATCTTGGCGGGCAGAAGCGGGCTTGTCAGG
AGCTCCTTCGCGTTGGGCCTTTTCGACGGATCACGTTCACATAGCCACAAAATGATTTTTTTGACGTCATCAGAAGCACTGAAAGCTGCTGGCAGCTCGT
GTCTTTCTCTTAGCCCGGTGAGTGCCTGTGCACGCTCCATCAAAGTTGTGAATGGCGGCAACCACATCTCAAAGAACATGATTCCAAGCGAGAACAGATC
CGCTTTCTGATTGTAGCGCTGGCCCTCTCGTTCCTGTTCAGGTGCTCGATAAAAGGCCGTGCCGACTCCAGCTGTGATACTACCGTCACCCACATCAGCT
GATATTGTTGTCATCAGATTGCTATGGTGCTGCACGCTTGATCGGCCGACAACACGCGTGCTCTCGAGGTTCTCCAGCTTCAGCCGGCCGTACAACTCAG
CAGCTGATGAACCTGTTGACTCAGATAATATCACGCCAGTTACCGTCTCTCCAGGTGGGGACGAGTCATCGTTGCTGCTGTCATCTTCTATGACCTTGGG
GGGACGCACAGCAAGTCCGAAATCGCCGAGCTTCACAGTTCCTTCGGAGTCCAAGAAAACATTGGGCGGCTTGATATCGCGATGGATAATTTCTTGGCGG
TGGATATACACAAGCGCTTCCAGGATCTGGCGGAACATTGTCCAGATCTTATCGGGGTCTTTCCATAGTGCACCCTTGTCAATAACCTCTCGAAGAGCGT
TGCCCTCGCAAAACTCCATCTGAATATACAATTTTTCAAACTTCCGCTTCTTTTCGGGCACAGCACTTTTGTGACGCAGAGTCTTCCGGTGGTATCCGCT
GTCTTCATCATCGCTTGAGTCCTCCATTGGTACTTCCTCCAGCGCCTCCCAGTCAAAACCATCATCCGGATAGCTCTCCGTAGCAAAACGATGTGAGGAC
AGCTGGAATGAATGGCTGTTGCTACGTAGGCTACGATTCTCGTGGCGGGACGTCGACCATAGTCCTGTACTGCTGCCCATCGTGCCTAGCCAGTCATCTT
CGTCCTCGTCTGTAGACGTCATCGGGCCCAATCCATCGTCAACACCAGACGAAAGGCTGGCATCCCCGTACATGTCTTCCTTGCCACCGACTTCATCCCC
GCTCAACGATCTCTCCTCATCCCTTAAATCACTGTCCTCAATACTCGAGTCCTCTTCATCATCGCTGGACATTCCACTCTCTCCTTCAATCCACGCCTGG
AAGTACCGCACAATATGACGGTGCTGCATCCGCGAAATGGTCTTGACCTCGCGCAAGATCTTCTTCTTCATCGTCTTGTCATCCGGGTCCAGTTTAACCT
TCTTCACCGCGTAGAGCTGTCGATCGAGCCGATTCCGTACCTTGACCACTTCACCTCCTCCTCCGCGCCCGAGCAGCCCGAGCTCTTTGAAGTCGCCGTG
ATACCTCGAATGATACCGTTCCGAAGCTGCAACCGCGTCCAGATCCGACGTGTCTGAGTCGGAATCCGACGGATTCGACGACGTCCCTCCCCGCTTGGAG
CTGGCCTCTGTTTGCTGCTCGTAGATACTGGACAAGCTCTCCATGTCGTCTCGACTCTCGTCCTCGCTGCCGCTAAACTCTCCGTCAATGCTGGACCGGT
GCCTCCTCCTGCGTCTCCGCCGCGTCTTCTTCATCGTCTCCCGCTTCTTCCTCTCGGCGTCGATCAGCGCCAGAATCTCCTCGTTCTTGGCCTTGGCCTG
CTCCTCCTGCTGCTGCAGCAGCGCGTCCTCCGCCTGCTTCTCCCTCGTCTCCCGGTCCTGCTGCCGGGTCATCATCTGGTCGAAGAACGACGACTGGTCC
TTGAGGTGGTCCTGGATGAAGTCCGTCGCGAACACCACGAGGTCGTACACGACGGCGTCCCCCAGTTTCTCGAGCGCGAGCTGCTCCATGCCGCGCTGCA
GCTTCTGCGTCTCCGTGTCCGATAGCCCGTGCTTGGGCTCCACCGTGATGTTGGGCGGCTGCTTGAGCGGGTACGCGCGCGTCAGGTCGAAGTGCAGCAG
CACCTCGGCGGTCGTGGCCGAGCCCGGCGTGGCCTCGCACAGCAGGCGGATGGCGAAGATGTACGTGTAGAGCGGCGTGGAGCTGTGCGTCTCGAGGTCC
TGGTCGTAGATGGCCTGCAGCACCTCCAGCTCCTGCGCCTGCAGCTCGCGCGCCTCGGCTAGCGTGGCGGCGTCATAGGCGGCGGCGGGCGGCGCGTCCT
GGGCGTCTACAGGGCAGCAAAGCGAGCGGGAAATTTAGCTGGCGAGCAGCGGGAGACGCAGACGCAGCAGCAGCAGTGTACCTCTCTTCTTGCCCTTCTT
CCGGCCCATGGACCGGGGCAGGGCGGCGCGCGGGTGGAGGAGACGGTACT