Description :
From Genome Similarity Track
Location :
Scaffold_279:19392- 21719
Transcript NameFunction/comments
g15901.t1hypothetical protein
g15902.t1hypothetical protein
g15903.t1hypothetical protein

Sequence
2327 bases(100 bases per row)
CGGAGTCGAGTGCCTGTAGTACCTCGACATGCCGCGAGCTGGACCACGGGTCGCTCACCTCGGAGAAGTGCACGCGACTGTCGCCCTCGCCCTCCATGCT
TGTGCTGTGGGGAGTGCGAGCAATCCCCTCGAATGCGTTTTATCCGTTTGGACAGGCTATACCCGTTATACCCGATAGTCTCCATGTATCGATTTCAAGA
GTGGAGATCGACTAAAGCGAGCCGCCTCTACAGAGTCCGTATAGGCTATCCGGATATTGCTGCCGTATGCTTGCAGCGTTGACTCACGAGGGACTCGGCC
GCCATCCGCTCCGCTGGCGCCTTCCGGTGCAATTTAGCGCAGGTACTGTAGATCAGTGACCTTCGCACGTTGGGGGTGGTTTGGTGGAGCCTCGCAGCTG
ATTGCCATCTTGCTTCAAGCTCGTGCTCTTGAGGATAACGCCACGTCCAGATGCTACTATCTCCAGGCTCTCGATGCACGAACGTCGACTAACCTTATCA
TTGCGATGCGCTTGTGGTGGAGAGAGGCGGAAGAGTGCGTTGCAATCGTCCGCCGCGCGCTACTTGTCCGGTTGCGAGCCTCGTGCTGCTTGTGGTGGTG
CGGCGGCGCGACGACTTCGTTTAGGTGACCCGCTGCTAGCAGCCTGCTAGCTCTCTGCTTTTCGATGCGTCGTTTCGGCGTCGTTTCGTGTTGTCCTCGT
ATTACGTTGGATAGCCTCGGATAAGATAGTTTGAGTGCAGAAATGTTTTAGGCTGGAAGCGTTCCCCTCATACATCATCTTTAAGTCCGAAATTAGATTC
CTCACACCACACCATCGATACATAACGAGTTTCCACCTCACGCGCGTCGTCATCGGTCCGCCCTTTTTGGCCTTTTTCAAAACGGTCAAAACCAAGACGT
CCTTTCCTGTTTGAGTACAGTAGCGTACAAAGTGCCATTCTTGGTCTATCCCGCCGAGCAACAGAGCAGCATGGCATCAGCCGCGGAGATCCGCGCCGAG
AACGAGCGCCTGTCGCGCGAGATCCACGCGCTGCTGAGCGCCAACACGACGCTGCAGAAGCAGGCGATGGAGCTCGACTCGGAGCGCGACGCGATTGAGG
CCTCTGGCAGCGAGAAGGTGCAAACGCTGGCGCACGAGCTCGAATCCGTCGATGAGGAGCTCTCGTCGCTGCGCTCGCAGTGCAGGTCCATGACGGAGAT
CCTCAAGAACGCAGACGCCCAGAACGAGGTGGACGAGGAGCCGGCACCGTTGCCAGGGAGCCGTAAGCTCTCCACGGCCATCAACCAGACGCTGCAGCGT
GCCAGGGGCATGTCGATGCCGCGCCAGCGGCGCTCGTCCACAGTGGATATGATGGCCCACGGGCTCACCAAGGCGGCGAGCTACATGATCCCACCCTCAG
GAAAGCACAGCCCCGACGGGCCTCGTCCGCCCAGGATGAACAAGGACAGCCCGCCGATCCTGTCGTACGCCAAGGGCACCACGGACTCGAAAAAGAGTCT
GTTGTTCTCCACTCACTCGCACTACGGCAACTTCCGACGGCACAGCGGACCCTATCGCAAAACCCGCGATACCGTCATGCGCATATGAGTTGCCTGTCCA
TCGCGTCGAGCCCACCCCGGCAAGAGAGAGAGAGCACTACCTTATTTAACACCAACCCAGCATGTTCAGCCATTGGAGCAGCTAGCTATCCGTCCAGTCG
AGCGTCGGGCGTCACGCCTGCAAGATCACACGTCCAGATCACTCACCACCAGGCATTCTGCTGATATCCCCCGCTGCATGTTTTTCCGACGGGCAGAAAA
GCAAGCAAGGGCAATCGTTGGTTCAAAGTTCGAGTGATGAACCACCAGAGAAGAAAGTCTTGGTATCCGCTATGCGTTTCATCGTACTCAGTCCCAGTTA
AATACAAGTGCCGCATCACGTTGTGCTGGCCTTCATCCCCTGCGAATCGTTTGCGGTTGTTGTTGCTGCTTTTCATGCTGCCTGAGTCAACTCGACCACA
AGACCCTGACAATCAACACCAAGCACATCGACGATGGTTGATATCTTTATTATGGATGGCTGATGGTTGATACAAAGCTAACTAGCTAGCTGGACAACGC
ACTACTACTAGAGGGTGACACGCATATAATCGAAGCGCCAAGAGCGGCAAACACGCTAACCTGCGAATTCGTGCTGTCGCCCCTGGCGTCTTTTCGTCTA
CTTACAGCGCGTTGGCCGACTTCTGGCGTGCCAGCTTCTGCGCCTTGAGCGAGGCCAGCGTGGGGCGCTCGAACTGGGACTTGCCGAGCTTGCGGTTCAC
GTAGTACACGCGGCCCGTAGAGCGCGA