Description :
From Genome Similarity Track
Location :
scaffold_552:19387- 20835
Sequence
1448 bases(100 bases per row)
ACCGCTGCTTCTAAACGAGTCGCAGATTTAGGAGTCCCCTGCAGTGCCCACTCAAGCAGCACCCAGGGTCGACGTGCCAGATTCGTATATGTCCGAAGCT
CCAGAAGGCAAGCCAATGTCGTCGGAGTTCCAGATGACTGAAGCCCAGGCAAAGGATTACGTGGCTGAACAGGTGCGGCGTTGGGAGCGTGATAGTTCCG
AGAGGAACTTTCCGCCCGAAGTTCGCTATGACTGACCACAAGTCCTCCTGTAGAGCGAGCCTGTCACCTCGGCTGCCTCGATGGCTTCAGAATATTTGAA
TCGTCGGATGGTGATGCCAGCTCAGATGGACACCTGGATGTCCGAGTTGCAGTTACAGCGTCGGGCGTTCGGAATGGCTCGAGACATTCAAGCTGCGCTG
ATTCCACCTTCGAAGTTAACCCCGCGAGAATGTATCGCTGTTCTCAGGACCATGCTGTTCGAGGCTGGGTTTGGTTTCGTCAACCTGATTACTGGATGGT
TTAGGACTCGAGTGGTCAAGGATCACCCATCCCTGGTTCGGCAAGTGGTTGAGGATGTCCTTCAGTTGTTGGTCGTCGAGATGATTGAGTGGGGACAAGT
CGTAGTCCAACCTCGAGAATGTGCCCAGATCTTGGCGACTTCCGGAAGGCAAGGTGTGGTGTAGTGGGATCCGCCAAAATCTGGTTAAGGCTCGATCCTG
GTACCACTGACGCACAGACACCGACTAACGGAGGGGGTGCTCCGATGATCCGCGATCTAGAGTGCTGAACTTGTTCACCTTGTGTACCCGGCAGTGGGCG
GGATCTGCTCTTCCAGGTAACTTCGAAGAGGTTCTGCGTGAAGATCTGAACGTCTTGGCAAGACGCAGAGGTCGTGGGGTAGATTGGCATTCTTCACTCT
ACCACCGCGTTGTAGATTCAGCGTCCTAGTCTTTTCCGTTGCTTGCTGCTTCCAATAGCGGGGTCTTAGAGTTGAGAGTCAAAAGATCTTCGGGCCATGC
AATAAAGTCCCTTAGATCTGATCTTGCACTTGGGGTAGATCACGAGTGTAGGTAAAGCTTCAGGAAATCACTTGACATTGGTATGGTCCGTTGGACCATC
CACTTGGAGTCGACATTTGGAGCTTGAACTTCAGATCTTGGACTTCTGAGGCTGCCAGAGGCTAGCTGGCTTGTTCCTGCTCGTTCACACTCACACCTGC
GTCCCAGAACGTCGAAATACTGGACCAATCAGAGTGCTCGAGCCAATGAAGCCTCGAGCACTCTGATTGGTCCAGTATTACGACGTTCTTCAGATGGCCA
AAGCACCAGGATACAAGAATTACAGCAAGGAGGAGTTGACACTACTTTCCACGCTTTTAGAGGTGTTTATCCAATTAATTCGACCGAATGGGCACAAGTT
ACAGAGCAATACACCACACCGCGTGGCTGACGAAGTGTCTGCCTCCAC