Description :
From Genome Similarity Track
Location :
contig_1:19385- 20650
Transcript NameFunction/comments
g3.t1hypothetical protein

Sequence
1265 bases(100 bases per row)
TTGAACTTCCATCTGTATATCTTGACCTCGTATCGGAATGACAGTAACATTGTACCTAGCATCCATCCGATCCAACTGTACCACTGTGGCGGTACCATGT
CGATCTGATCAGGTGAGTCCAGATGATCGCGTATGCCCAGATGATCGCAGATGTCTGGTTGATCGCAAGCGTCCGGATGATCGACTGTACCGAAAGGGTG
GTACCAGGCGATAAAATTACCTGTACCATCATTGTGGTACCAAGTCAGGTGCTGGGCTATCCGGACATATCCGGCACCAACCCCAACCCTTCTGGTCCAA
TCAGTCCAGACGCGATCTCTTCCCATCATCGGCAATTTGACCCAGGTCGCTTCACCTCAATCGCCCCCTGCTCTGCGACCAGCCGTACGGCGGTTGGTCT
CAGCGCACTCCATCACATTTCCGCTTCCTTCTCTGAACCACCACCGGGGAATTCCGTGCCAGCCCCAGTTATGGCTGGTGCAGCTGACGCACCGTCCGAC
GATCCTCTCGTCGTCGCGCCTGATACGTCCGCCGATCACACCTCCGAGGCTCCGGTCGTCTCTACTGCTCGCGTCGCACTTCCTAGCGTTAACCTCGGTG
CCGCCCGGGACTCTCTCGCATTATTCTCGTCCCTGCTGGAACGCATCGAAGCTCAAGCTGATCTCGACGATGCTCATGCAGTATTGCAGCAGGCATATCG
TGGACCAAGTTGCGCGAGCGGATCGATTGGAGGCCGATCTGAACGCCGCGTACGCGGCTGCTTCTCCCTATGTGTTGCATTGCCAGCACCAATATGATCT
CCTATTCCGGCGCTATCAAGAAACCCGGCAGATGGCGGCCGACTTCGAAGCGGCAGTGCGCGAGCGTCTCGACAATTCGCACGAGATCGCAGCCATGCGG
GATCGTTTGCGCGTCGCACAGGAGGTCCTCGCGGAGGAAACCACGCGATTACAGGCGGAGTTTGCCGATCAACTCGTCGTCTGGCTGATGCAGAGTCTCC
GGTGGCTACAAAGCAGCCGCATGGGTCAGCACGTCGTCTCGCCACATTACAGGAAGGGTTGGACCAGGCGATCGCAGATCGCGACCGCGCCGCTTTGGAT
TTGGTCGAAGCCAACAAGAACCTTGGTGCACTTGAGTCGTCGCAGCGTGCATTGGAAGACGCGACGTCTCGACTACGCGGTCAAAACGAACGTCTCGAGC
AGCGCGTGTCTAATCTTCAAGCGCAGCTGGCTCAACAAACAGCTCGGGCCAAGCGGAACTTCGAT