Description :
From Genome Similarity Track
Location :
Scaffold_4:1938448- 1945593
Transcript NameFunction/comments
Phyin_T30-4PITG_03488Dynein heavy chain
Phyin_T30-4PITG_03489Putative uncharacterized protein

Sequence
7145 bases(100 bases per row)
CTCAAGGAAATGTCGTGGCGAAAGATTGTCGATACTATTGTTCTCGCAGCTATGGGACCTTCCGGAGGTGGACGGAATAACGTCACTCCTCGCTTACTTC
GACACTTTAACCTGTTGTGCTTTTCCGAGTTTGATGACGCGACACTCACTCGTATCTTCACGACGATTCTGGACTGGTACTTCGGCTCAAACCCCTTCGT
TCCAGAGGTTAAACGACTGTCGGAAGCCGTGGTTTCCGCCACCTTGGAGCTGTATCAATCCGCGATGATGTCGCTTCTCCCCACTCCTAAAAAGTCTCAT
TACACATTCAATCTAAGAGATTTCTCTCGCATCGTCCAAGGAATTATGCTTGTGGTACCGAACGACCAGTTCAGTGCTAATAGTTTAGTCAAGTTGTGGG
TACACGAATCGCTTCGAGTGATTGGTGATCGTTTGATCGACGATGAGGATCGAGAATGGTTCAATGACGTTCAGAAGAAAATCACCATCAAACACTTTGC
AACTAACTTTGACAAGGTTTTTGCAAGCCTCAAACGTGGTCAAGAAGGCCCCGTTACAGCTGTTGACATGCGGAATCTCTTCTTTGGAGACTACATCGAT
CCCGATGCAAGTCCGAGACTCTACAAAGAAGTCGACGTTCGTCTGGACTCTGATTTCGACGGTATCGCACAACTGATTCAATGTCTTGATGGATACTTGA
CGGAGTACAATGGAATTAGTCGCAAGCCAATGAATCTCGTCATGTTCTTGTTCGCCATCGAGCATTTATCGCGAATAGTTCGCGTACTCAATATGCCTGG
AGGGAACGCGCTTCTTGTCGGTGTAGGTGGCAGTGGACGTCAGAGTCTTACGCGGTTGTCAGCGTTTATAGTCGACTTTGAGATCAAGCAGATCGAAATC
TCAAAGAACTATACAATGACCGAGTGGCGCGAAGACATGAAAGATGTCTTACGTATGGCTGGCACTGGTGCAAGACCGCTGGTGTTCTTGTTCAGTGATA
CGCAGATCAAATACGATGGCTTCGTGGAAGACATCAACAATATGTTGAACTCAGGAGAAATCCCCAATTTGTTCCCGTACGATGAACGTGTGGGCATCTG
TGAAGCTGTTCGTCCTCACGTTAAGGAAAAATTCGGCAAGGCAGTGGGGGACAATATGAACCAAATGCAACTGTACGCGTTTTTCCTGCAGCGAGTGCGT
AGTAACTTGCACATTGTGCTGGCATGTTCGCCTATTGGCGACGCCTTTAGAGACAGATTGCGGAAGTTCCCGTCGCTGATTAACTGCTGTACCATTGACT
GGTTCACTGCGTGGCCGTCCGATGCTCTTGTGGCTGTAGCTGAGAAGTTCTTAGCTGACGTCGAGATGGATAGTGCAAATGTCCGCAAAGCCATTGTAGA
CACTTGCCAGTATTTCCACGTTAGTGTGATGGAGCTGTCCGATAAGTTCTTGAAGAATCTGCGTCGTCAGAATTACGTGACACCGACGTCGTATCTCGAG
CTTATCGTGGCGTTTAAGAGTTTCCTTGCACGTCGTCGCGAGGCTGTACAAGGTGCTCGGAACCGGTATGTTGTGGGTCTGGAGAAGATCAACTTTGCAG
AAAACAATGTGGCGGTGATGCGAAAAGAGCTGGAAGACTTGCAACCTGTTCTTGATCAGTCTAAAAAGGACACAGATATTCTGATGGAGGAGATCAAGGC
CAAGCTCCCTGGAGTCGAGGTACAGCGTAGTGAAGTACAAGCTGACGTCGCGGTGGCCGATGCTTCTAAGGCGGAGTGTGAACAACAGAAGGCCAGTGTC
GAGGCCGATCTCGCGGAAGCCATCCCAGCATTGGAAGAGGCTTTAAAAGCTTTGGACACTATCAAACCCAGTGAGATCAACGAAGTCAAAGCCATGAGTA
ACCCGCCAGCAGGTGTGAAACTGGTATGTGAAGGAGTTTGCGTCATGCTTGGCATCAAACCTGCTCGTATCCCAGACCCCCAAGATCCATCCAAGCGTAT
CATGGACTACTGGGGCCCTTCACAGAAGATGCTCAGCGATCCGACTTTTATCACGACGCTCAAGAAGTTTGACAAGGACAATCTTGACTCAAAAATCATG
AAAATCGTTGTCAGTAAGTATATTGCGGACGAGAATTTTAGTCCAGAAAAGGCAGAAAAGGCCTCGAAAGCAGCAGCAGGATTGTGCAAATGGGTCCACG
CGATGGCTTTATACGACAATGTCTCAAAGGTTGTTGCACCCAAGCGTGAGGCACTACGCGTAGCTGAAGCGCAACTCGCTGAAGTGATGCAGAAACTCAA
CGAGAAACTGTCCCAGTTGAAACAAGTGGAGGACGGTTTAGCAGAGTTGCAGCGGCAATTCGACTTTGCAACCAAGCAAAAGGAAAACCTCGAGTATCAA
GTGGATCTTACAGGTAAGAAACTCATCCGAGCGTCCACATTGATTGAAAGCCTTGGAGGTGAGAAGACGCGATGGACCGAGTTTGCAGAGCAATTAGCGG
CTCAGTACAGCAGGTTAACTGGAGACGTGTTAGTCTCGGCCGGAGTTGTGGCATATCTCGGGCCTTTTACGTCGTTATACCGACAAGATGCGGTACAGGA
CTGGGTGGGTCGTTGCAAGCAGCTTGGTATTCCTTGCAGCGACTTCCCATCTCTCAACGGATCGCTTGGCGACGCTGTGCAAGTACGAAAGTGGAATATC
GACGGACTCCCCACTGACGGCTTCTCGGTTGACAACGGCATCATCGTCTTCAACTCACGTCGATGGCCACTAATGATTGACCCACAAGGCCAAGCTAACA
AGTGGATCCGTAATATGGAAAAAGATAACCAAATGACGGTGATTAAACTCACAGATGCCGACTACATGCGAACGCTAGAAAACTCAGTTCAGTTTGGCAC
TCCCGTGTTGCTGGAAAATGTTGGCGAAGAGCTTGACCCGTCACTGGAGCCTTTGCTACTGAAGCAAACTTTCAAACAAGGCGGAGTGACGTGCATTCGT
CTGGGTGATTCGACTGTTGAGTATGCGGAGAGCTTCCGCTTCTACATCACGACCAAGTATCGGAACCCACACTATTTGCCGGAGGTTTCTGTGAAGGTGA
CATTGTTAAACTTTATGATCACACCTCATGGTCTTGAAGATCAACTTTTGGGTATTGTTGTTGCTCAAGAGCGACCAGATCTGGAAGAGCAGAAGAACAA
ATTGATCGTACAGAATGCGCGAAACAAGGGACTACTCAAGGAGATTGAAGACAAGATTCTCAACATTTTGTCATCGTCCCAAGGAAATATTCTCGAGGAC
GAAGATGCTATCAACACGATGAACCAGAGTAAACAAGTCGCAGACGAGATCAAAAAGGAGCAACAAGTTGCCGAGAAAACCGAGCTGGAGATCGATTCGG
TCCGACAAGGCTACAAGCCTGTGGCTTATTCAAGTCAAGTGCTTTTCTTCTGTATCGACCAGCTTGCGAACATTGAGCCAGTGTACCAGTACTCGCTCTC
CTGGTTCATCAACTTGTTCATCGCCAGCATCCAGAACAGCGATCGATCGCCCGATCTCACCCAGCGACTGCACAATCTTGACGCTCATTTCACGTACTCG
CTTTATCGCAATATCTGTCGCTCCTTGTTGGAGAAAGACAAACTCATGTTCTCGTTCCTACTCTGCATTTCTATCAAGCAAGGAAAACACGAAATCGAGA
GTAGCGAGTGGTATTTCTTGCTCACTGGAGGTGTAGCGCTCTCTGAACCGCCTCCGAATCCGGCCAAGCTGTGGCTAAGTGACAAACAGTGGGCCGAATT
CTCGAGACTAAGCGCACTACCAGCGTTCCAAGGCATCATCGAGGATTTCGTCGATAACGAGGACCAATGGAAGGCTGTGTATGATAGTCCAATCGGTCAT
ACTCTCCCGTTCCCCGGTGTGTTAGGGAAAGTTAGTGAGTTCCGTCGACTACTCGGTCTACGATGTATCCGTCCTGATCTTCTCGTCGTTGGAATTCAGC
AGTTCCTGGTCAAGGAAATGGGTGAAAAGTTCGTCAAACCTCCGCAGTTCGATTTGGTGCTCTCTTACTCGGACAGCAGCGTGTCGTCGCCTTTGGTGTT
CATCTTGTCGCCTGGATCCGATCCGATCAGCTCTGTGCTGAAATTTGCCGACTCGCTTCGTCAAAGAGCAGAAACGATTTCTCTTGGTCAAGGTCAAGGC
CCCATTGCCGAGCGTATGATTGTCCGTGCGCGTGAAGCAGGCTCTTGGGTTGTGTTGCAGAATTGCCACTTAGCACCAAGTTGGATGCCAGTGATGGAGA
AGATTGCGGAGGATATTAAGCTTGACAACACACATCCAGATTTCCGGTTATGGTGCACAACGTACCCGTCCGATGTTTTCCCCGCAGCTGTACTGCAAAA
TGGAGTTAAAATGACGAACGAACCGCCACAAGGTCTTCGTGCAAACCTCATGAGCTCGTATATGTCCGACCCCATAGGTGAGCAAGGGTTCCTGGAATCT
GTGGTCAAAGGCACAGAGTTCCGTGTACTTCTTTACTCGCTGTGTTTCTTCCACGCTTTGGTGCGTGAACGTCGCCAGTTTGGTCCTTTGGGCTGGAATA
TTCAGTACGAATTCAACGAGTCCGACCTGAGCATCAGTATTCGTCAACTAGCCATGTTTATCGATGAAAACGCGCAGTTGCCGCTACGTGCGTTGAATTA
CTGCACCGGTGAGTGTAATTACGGTGGGCGTGTGACGGACGACAAGGACCGACGGACACTTATGTCTGTTCTGGGCAAATTCTACTGCGTAGACGTGTAC
AAAGAGGGCTATGCGCTCGATGAACAAGGGGTCTACACAATGCCGCCTGATGGTGACTATGATTCGTATCTTAAGTTCATTGAAAGTTTGCCGCTAGTGG
CTCCTCCGGGAGTGTTTGGACTGCACGATAATGCAACGATCACGAAAGATCAGAATGCAACAGCCAAGCTCTGTCGCGACGTGCTACTTACTCAAAGTTC
GGGTGGTGGCAGTGAAGGCAGTAGTGGATCATCCCAAGAAGAACTCGTCGAAGTCGTAGCCAACGATATTTTGTCACGTTTACCGCCGAACTTTGACATG
GAAGTCGCGCAGATCCGATACCCAGTGCGTTGGGACGAGTCGATGAACACGGTGCTCTGTCAAGAACTCGTACGCTTCAACAACCTCATGTCAACTATCC
GCTCGAGTCTTGAAAGCTTGCAGAAAGCCTTAAAAGGCCTCGTGGTCATGTCGGCAGAGCTCGAAAATGTATCCAAGAGCTTGTTCTATGGAAAAATCCC
AGCACTGTGGGCGTCCAAGTCGTACCCTTCGCTGAAGCCACTCGGTAGCTACGTGACGGACTTACTGGAGCGCATTGCGTTCTTCAACACGTGGCTACTG
GAAAAACCTCCGGTTGTGTTTTGGATCTCAGGTTTCTTCTTCACGCAAGCGTTCTTGACTGGTGCCAGTCAGAACTACGCGCGAAAATACACTTTGCCAA
TTGATCAGCTGGGGTTCGACCACGAACCGATGCCACGGAATGACTACGCACAGCCACCAAAGGTACGCTTGCAAATGACAAAATAAGGTGAGAACTGGTA
ACTTATGAGTCGTTTTACTTTTGTCAGGACGGTGTGTATGTGCGCGGGTTGTTCCTCGAAGGTGCCAAATGGGATAAGACAACGCATGAGTTGGGAGAAT
CAGATCCGAAGGTGCTGTTTTCGTTGGCACCGGTGCTGCTTTTCCGACCAGTGAAGAAGACCGAAATGAGTCAACGGAGCTCGTATTCGTGTCCAGTTTA
CAAAACGAGGTGCGTTTTCTGGAAGTTTTGCTGTACAAGTGAGGTCATCCTAACTTTTTACAATTCTTGTTAGCGAGCGACGAGGTACACTGTCAACCAC
AGGCCACTCGACGAACTTCATCTGCTTCATTCGCTTGCCAACAAGCAGGCCAGAGGCGCATTGGGTCGCACGTGGCGTGGCCATGCTGTCCCAATTGGAT
GACTAGGTTGTATATAGAGAATGAAAGGTCTCTAAGTGCAAGTACGCGTGAAATTTATTACAACCCTCGAAGAACTTGCCGACAAAATTTCATGTCGCCA
CGATGGTTGCGCGACGACAGTCAATTCTTTTCTTACTCTGAAGTAGAAGTATTCGGTTAAAGTGCCGTTGAAACTGAGCAAAACACATCTATTTTTTCTA
TGTCGGTGTTTGATTCGCATATCCGGGCTAGGGAACCTTATCCGCGACCGCAGCGTTGTGCGATTGTGCGGCGAAATGGTCTCTGCTCTTCCGGTCGTAT
CGATATCGCGCACACCGCGAGATTATCGCTCATAGCTAGTGCTGCTGGCATCACAGCATGAGCGTATCCATCGCCTGCTGGAAGTTCGCAAGGACTTCGA
GAAGCAACAGCGTTCGGACTTAATGGAGGCTTGATAGAAGAGATGGGCGGGGATATCCGCCAAAAACGGGCCATTTTTGCGCTTCAAATGGCAAAATTGA
CTTGACTTTTGTAAGACCGGGTCTCACTTTGTGCAGCGCTGGGTGCATTGCATTGCCATCGTCCAACACATTTGCGCTTTGTGGCGGAGGCAACAAGGCA
CGACCGATCAGCTCTGCTCTGAGGCAATTATCAACGCGCAGCCCTCACTTCCCCCTTACTTTCCTCCGTGAAAAAGTAGTTGCCGTCATCATGGAGTGGG
AAGCGCAATGCCTCGAGTGCGACGAAGTGCTGGACGACGACGACCTCATGAGCACGCAGGATTCCGAGACGGGCGTGGTGCTTGGACTCCTCGTGACAGA
CGTACCCTGGACGGCCGAGCTCTCGTTCGAGGAACAGAGCGTACGTCCTTCCTTCTCCCTACGTTTCTTGCCTCGCCATGTTGACAATTATTTTCTGACG
ACAATTTTTTTTGTCAATGTGGTTTAAATCGTTAGCTGGTGGCACTGGAAGACCGCGACGTGGACAGCGTGTACCGAGCCATGCTGCGCCAGGAGCTCCT
TCGGCCAGACTTCTCCAAGCAGTACGAATACCTCAAATATCGTCGCGTGCTTGTCGACTGGATGTCCGAGGTGGGGGAGACGCATTTGCGAATGCGCAAG
GAATATGTACACGCCGCTGTTGGATATCTCGAGAAGGTATTGGCA