Description :
From Genome Similarity Track
Location :
Scaffold_22:193829- 196301
Sequence
2472 bases(100 bases per row)
CAGGATGTCGTCCACGTATCGCCGCTGGCACATGGTCACGCTGCCGTCCGGGCCGTCCACCAACTCGATCCCAAGAACAAACGCGCACTTGCCGCTGTCG
GTCATCTCGAAGCGCGTCTTCAGGTCGGTCTTCGTGCGTGCGATCAGCTCGGGCGAACTCCCGGTAATCAGTACGTCATCCACGTACACCAGTACAAGCA
CGCAGTGACCGTCCACCACCTTGATGTAGAGGCACGGATCGAAGGCCGACACTTGGAAGCCGATGGAGCACACGAACTCGTCGAAGGTCTCGTTCCACCC
TCGCGAAGCTTGCTTGAGACCGTAGATGGCCTTCACCAGTTCCAGGCAGTCGAAGTCACCATCCAGTTCGACGCCTTCCGGAACCACGCAGAAGACCACC
TCCTTCATTATCCCGTACAGGAATGCTGTCACCACGTCGAGTTGGTCGAGGGGCCAGCCAAAATACTTAGCAATCGCGATCACCATGCGCAGTGTCACAT
ACTTGACCACGGGCGAGAACGTCTCGGTGTAGTCAATGCCGTACTTCTGCTTGAAGCCCTTGGCCACGAGGCGCGCCTTGTACTTCTCGATCGAGCCGTC
CGCTTTGCGCTTGATCTTGAACACCCACTTGGTATCGATGGCGCGTTGTCCGTTAGGCAACTTGGCAGCTCGAAACACACCACGCAGTCGCATCGACTTG
AGCTCCGCGCGGATCGCTTTGCGCCAGTGCACTTGATCAGGACCGTTCACAGCCTCTTGGAACGTCGTCGGCTCCGATAGATCGGCTGCTGCTTCCACAG
CGTTGGCACTGGCACGCCAAAACACTGGAGGCGTCGAGTCGTCGTCTTCATCTTGGTCCCCAGACTTTTCTTCTTCATCGGGGTCGGCTCGGCGCGAGGA
GGATACGCCCGGCGCACTTGCTTCTTCTAAGCCAGCTCGGTGGCGAACGGGGCGCGATCTTCTGGCAGTGTTGTCGTCGCCACTCGGTCGGTACTTGCGC
TTCCCCGCCTGCTTGAAGCTCGTTTGGCGCGGTCCATCGTTGTCGTCCAGGTCCAGCGCGTCCAAGTCTAGCACAGCATCATCGACGTCTTCATCCGAAG
TATGCGTCGAAAGTCCAAAGGTCGACTCATCGAAGTTGACATCGCGACTGATAACCACCTGCCCCGCCTCGATGTCATAAACTCGATACGCCTTGGACAC
TTCTTCGTAGCCGAGGAACAGCCCGGCGCGAGCCTTGGGGTCCCACTTGCGCCGTCTTTCCTTCGGCGTCAGGATGTACGTCTGGCATCCGAACACACGC
ATGTGCTTCACACTCGGCTTGGACTTGTAAACGATCTCGAACGGAGTCTTGTGTTCGATCTTGGGTGATGGCAGACGATTCTTCACGTAGATGGCTGTCA
TGGCCGCCTCAGCCCAGAAGCTCTTGTCCAGCTTGGCGTGATGCAGCATGCTGCGGCCAATCGTGACGATGGTCCGGATGGCGCGTTCTGCCGTGCCGTT
GGTCTGGTGCGCGTACGGAACCGTGGTTTGCTGCTCGATGCCTTCGACTTCGTAGAAGGCCTTGAGCGAGTTGGTCGCGAACTCACGGGCTCCGTCGTGC
CGCACAAACTTGACCTTCTTGCCGAACTGCGTCTGCACCTTCGTGACGTACATCTTGATGCAGTCCTCGCTCTCCGACTTGGCACGCAGGCAGAACCCCT
TCATGCATCCGCTGGCTTCGTCCACGATCAGCAGCAGATACTTGCTGCCACCCAGTGACTCTTCTTCCATGGGGCCGCACACGTCGAAGTGGAGCAGCTC
GAACGTGTCGTAGTGACGCTTGTCACGGTTGCTTGGGAACGGCTTCTGGACCATTTTCCCTTGCTGGCAGCCGCGACACACGCTTGGTCCACTCGACTTG
GAAGGTGCCTTCGCGTCCTTGATCATGTTGTTGTCGACCATCTTGCGAAGCACCTCCACCGGAGCGTGACCCATACGCGCGTGTAAGTCGACCGTCTTCC
CACTGGTCGCCGCATTCGCCGATCGCTGAGGCGTCTGGAGCCAGTAGAGTCCATCCACGAGGTTTGCCGTCGCCACCACTTGCTTGGAGCCCTTGTGCGC
AATCTGCATCTTGGTGCTGTCGAACACGACTTGGAACAGACCACTCTTGTTGATCTGTGGCACCGAAAGCAGATTCTTGCTCATGCTTGGGACGTACAGC
GCGTTCTTGATCTCGATGTCGCGCTCGTCGCCGTTGGGCAGAACCACTCGTTCCACGATGGTCCCCACACCCATGATGGCCGCCTTGTTGCCGTCGGCCA
GCCTTCATTCCGCTCAATCAAATGAGCGAACTTGGCCTTGTCGTTGCAGATGTGGTGCGTTGCGCCGCTGTCGACCGCCCACAACCCGGACACATTCTTG
CCCGTCGAAATGCCACACTCCAGTGAGACCGCGAACGCCACTCGATCATAGCCGTAGTCGTAGTTGTAGCTG