Description :
From Genome Similarity Track
Location :
contig_53:193815- 195448
Transcript NameFunction/comments
g8786.t1ATP-binding Cassette (ABC) Superfamily
g8787.t1ABC transporter-like protein

Sequence
1633 bases(100 bases per row)
ATCCTCAACAACGTTTGGGGTCGATCGGGACCTGGCGAGCTGACGGCCATCCTTGGACCATCGGGAGCCGGTAAGACGACGCTGCTGGATATGCTCGCGG
ACCGAGTGCCGTCGGGAGGCTCGGGCGTGCACCTTGAGGGTCTCGTGGAAGTAAACGGACAACCCCGCGACCTGCGGACTTTCCACTCCATCATGAACTA
CGTGTCCGAAGACATGGCGTTCCTCGGAGCATTCACGGTGTTGGAGACCCTGCAGATCGGCGCCGGTTTGAGTCTGCCCGGCCACATGCCCCCGTGCAGC
GTGAGGCTCGTGTTCAGGATGTGATCGACGCTATGGGACTGCGGACGTGCGCCAACGCCCGCGTGGGTGACGTCTTCCACAAGGGAATTTCGTCTGGCCA
GCGCAAGCGTCTTGGTATCGCTCTGGAGCTGCTTTCGGACCCTGCTCTTCTTCTCCTGGACGAGCCTACGTCGGGGCTGGATTCGTCTTCTGCTCGTGGC
GTCATGCAGTACATCGAGCGGTTGTGCCAGGAAGGCGGCAAGAACGTCGTGTGCACTATCCACCAGCCTTCGTCGTCCATCTACGGCATGCTCACGAACT
TGGTCATCCTGAGTAGCGGTGAGCTCGTGTACAGCGGACCCACCAACGCTGCGATTGCCCACTTCTTCTCCATGGGCTACGTGTGTCCGATGTACACGAA
CCCTGCTGAATACTTCGTCCACTTGGTGAACACCAACTTCCACGAAGGCCTCAAACTCGAGCCGTTCGTCCGAGCGCTGAAAGAAGGCACCGAGCCGCAG
CGTCTCCGTGCTGATGTTGTGCGAGACCGCGCTCGCCGGGATCACCTGGCAAACCCGGAGCTGCTGAAGGCCATGCGGCCGTGGCCTATGGACCAGTTCT
TCGTGCTCGTCAAGCGTAACATGACCAACAACTGGGGCATCCCGGTGTCTTCTGGCTGCGCGTGATGATGTACGTGCTGCTGTCGCTGATGGTGGGAACC
ATGTACCTGAGCTCGAACAAGGACATCAAGGATATCTCCATCGTGCCGCTGCTCTTCTACGTGCAAGCTTTCCTCGTGTTCATGTCCGTCGCTGCCCTGC
CCGCTCTGCTGGAGCACCGTGCAGTCATGGAGCGTGAAATGCGCTCGTACGCGCTGTCTCTGACGGGCTACACGATGTCGAACCTGCTGGCTTCGCTGCC
AGGTATCCTACTCATCTCGGTACTCGCGTCCGCCATTGTCGTGTTCCTGGCCAACGTCAATTCGTTCGGGATGTTCCTTCTGAACCTGACGCTGTCGCTG
ATCGCTGCCGAGTCGTTGATGCATCTGCTTGGTGCTGCGGTGCCACACTACATTATGGGCATCGCACTCGGAGCCGGTCTCTTCGGTATGTTTATGCTCT
GCGAAGGCTTCATGGTGCCGTTCGCAGACATGCCCGTGTACTGGAAGTGGGGCTACTACATCGCCTTCCACACGTACTCGTTCGAGTCGTTCATGTACGA
GCACTTCTCCCAGGTGAACACGACCGAGTCGTGGGATCTGCTCAAGAGCTACGGCATGGACGATGTGAACGTCATGACGGACATGATTATCCTGGCATGC
TACTCGGTGGTACTGCAGCTTCTCGTCATTGGG