Description :
From Genome Similarity Track
Location :
Scaffold_109:193765- 195546
Transcript NameFunction/comments
Physo_142197reverse transcriptase

Sequence
1781 bases(100 bases per row)
CAGTCGCGTTGGTCGACGTCTGCGATGTACATCTTGATCGCTGTTGTAACCGTCTACACCATCCGTTCTGCAGCACCGTTGGCTTGGGGACGATAAGCAA
GCGTCGCTCGCTGTCTCTGACCCATGTGTTTGCTGAACGCCTTGAAGACGTCGGACATGAAGCCCGGCTCGCCGTCGTGGCGGATAGCCTCGCTCGCGCC
GAAGCGCCTGAACACCGCCTCCTCGTACGCCTCGGCCACCGTCTGCGCGGTTCGTGACGCATTCGCTTTGACCACGACGAACCCCGTGAATAGGTCGACC
CAGACTAACAGCTCTGTGTTCCTTTGTAGGATGCCGGTAACGACGGAATATGGTCCATGGCAATGACCTGGAACGGGTACGTCGCGACGATGTTGCCCGG
CGACTCGCCCTGGATGGTCGGCCGATCCTTTCCCGGTGCATTCGCCGACGTAGCGCTGAACGCTTCTGAAGATCCCTGGCCAATGGAAGTGGCGCCTCAC
GCGTTGGTACGTGCGGCCAATACCCTGGTGTCCGCCTTCCAGGCTCGCGTGATAGTGGTGGAGTACATCTTCCCGAGAGTCTCTGGGATCACCAGCTTCA
TCATCACATCGCGATCCTCGGCGGAATCGTCGCTTCTCGGCTGGTAGTAGAGCAGCCCGCCTTCGCCCTCTTCGTACTGAGGCGCAAGCTTTTGGCAGTT
CTTCACCTCGCGCCGAGATAGGTCTCCGACGTCGCCGCGGAGATACTTCTTGAGGTTGACGATCCAGACCTCTTCGTCCTGGGCGACGCGGATGCGGTCC
AGGCGCAGTCGTTGCACTACCAGCTCCTCCAGGACTTCTGGAGGTCGGACCCTACGTGTTGTCGTGCGTGCGGCAGCCGAGCGCGTCGTCACAGCGAGGA
CTTGTGCTGTCCCGCGTCCCGCGTCCATGGCCTTCCCGGCGGGGTCACCTGCGCCGCGCGTTTTCGCGTCGCGATTTTCCGCGTCGCGATTTCCGCGTCG
AGGTTTTCCGAGTCGAGGTTTTCCGCGTCGAGATTGTCCGCGTCGGGACTGGCTGGAGACGCCATCTCGGGACTCGATGCCCGTGGTCGGATGACTTCTT
CCAAGCGATTCAGCGTCTTCAGATCTTGAATCTCTTCGGGGCTGTGCGCGTTGCGGCCTCCTTGACGCTGCAGAGCTTGTCCAGCCAGCATGTCGGCACT
CGCGTTCCAGTCTCGTCGTACGTGGAAGAGTTCGTGACGCGGCCATGCCTGGAGTGCGTTTCGCGTCGTTTGTCGCAGCAGCTTCAGCCCCGGGGACTTG
CAGTCCATCTCGTCCCGCATCTGCCTGATAACAAGGTTGGAGTCTCCGCATACGACGAGTCGGGTGACGTCGTCGAGCTCCTCTAGAAGAGAACATCCGA
GCAGCAGCCCGCGGTATTCGGCCTCGTTGACCGTGAGGTCCGTCGCATATCCCGACGCGGCGCGTACGATATCCCAGTTCGGCAGCTGCCAAATGACGGT
ACTGTATGCTCCGCCTTCTCGCTTCGCCTTGGCCGATCCGTCAAAGCTCAGAACGTGCAAGACCTCGTCGCGCGCCACGTCGGGGACTGGAATGACTACA
ATCCTGGACGCCCGTCTCCGTGGGGCGATCTCTTCTAGCGCCGCGTCGACGAAGGCTCGCGGGGTAATGCTCGCGGCCAGCGCGCCGAGGAGTTCTTCTT
CTCCTTTCATGGATCGGCAGATTTCCAACTTCCACGGCGAGAGGATCGCGGCCCACTGTGACAGTCGCCCCTGTAGTCCTT