Description :
From Genome Similarity Track
Location :
Scaffold_304:19373- 22902
Sequence
3529 bases(100 bases per row)
GGGGGGCAGGGCCTTGCGAGCAGTCGGAGAGAGGAGCGGTCAACGAAGTGCGGGTACCAGGTACCGAAGATGTCGAACGAGTCGCGGGCGTGGGATATCA
TGGTCGATCTCAATAGGGGTGCACGCCAAGCCATCGGTAGATCGCGCAGTCGAGGCAGATGACCGCCAGCGAACGGAAGAGCGTGATCGGGACATCGCCG
CAACCATGGCCTCGTTGACAGACCCAACGGAACGTTCGCCATCCAGTGCGGAGGAAGCAGATGGGGGACTCACTCGCTTCTACTTCTGCGACCGCCTGGT
CATCACCGACGGAGAAGTGTTTGTAATCTTTGACTTGGATGATCTCCGGGTCGTGGGGGTCGGAGGTTCACGAACTTCTATGCAGGACGCGAGGTCTGCT
GTGTCTTGGAGTGATCCGAAGCTGACCGTCTTTGGGTAGCGTGGTCGACAGCCGTGCGACAGTGGTTGGAGCTCCAGGAGGCGAACTCGGGGGAGCAGCG
ATGCGTGGACGCTTGGAGCTATCCGAAGCTAACCGTCTTTAGGTAACGGGGTCTGCAGGCCGTGCGACTGTGGATAGAGCTCCAGGAGGCGAGTTCGGGG
GAGCAGCGACGCGTGGACGCTTGGAGCTATTCGAAGCTAACCGTCTTTAGGTAACGGGGTCGGCAGGATGTGCGACTGTGGATAGAGCTCCAGGAGGCAA
ACTCGGGGTAGTAGAGATGCGCGGACGCTTGTTCGGGGGCGGGACGGGATCGACCACCTGTTGCTCCCTCCGCCGTTTGTCATACGCGAGTTCCACCGAC
GGTGGCAACCCGATGACAAAGTCTACTACATGGGCCAGCTGAGCTTGACGATCACGAACGAGAAGGTTCCGCTCTGCCCTCAAAAGCTCCAGTTCTTCAA
CGTGAGAGGCGTGGGAAGAGCGTAAATGATGAAGCTCCTGGTCACGAAGTGCGCGATCAGTCTTCATGCAGTCGATCTTGCGAGCCTGTTCAGCAACACT
GTGAGCAAGCAAGTAGTATCTCTTCTGGAGCGGGTCCACAAGCCCCTAACCTTCATCCACCGCTCGCTGCAACTCGTGGCACACTTGGGCCAGTCGGTCG
GCTTCTACATGACATTCACGCCGCGCCGCACGGAACCGCTCATAATTGTGTTGAGCGAACTGCATGAGCGGGAACGCTATAGTGATCCAACCCCTAAGTT
CTTGCTCAAGTTCGTCTCCACGTTTCTTCTGCATCCGCAGAGCTGTTTCCAGTTCCTGGTCGAGGTGAACAAGTCCGCTTGGAAAGCGATACGCCGGTAC
AAGGAAGTGATCAGAGTCCCCACAGAGCTGCCGTCGTCGGATGGCGGGGTCCTACTCGCGAGTCGGGAAGAAGTACCGAAGTTGCGTGGTTGTCTATTAC
ACGACCACGGCTGGTGCCGGGAAGAGGAGCCGGGCCATCAAGAATGATGACATGGGCGTCAACACCTGCATCAGCAGCGACCACGATGACCGGGTCGGTG
GGCCGGCCAGCAGGAACTTCCGGCTTTCTCGGCGATGGACGCGCCTGAATCAACGACGAGATCTTCAGGGCCGTTTTCAGATACGGCAGAAATGCGTGTT
TGCTCGACAGCAGTTCGCCAACATGGGGCGTACCAAGGTTAGTGGGGACGCCGGCGGACACAGCTGGGAGGTCGACCGGCTCCACGAAACGATCGGCAAC
GGCAGCGTCGGTCATAGCGGAGTCAGGTGCTTCATCACCAGGCGCTTTGTTTACACGAGGTGGGTCACGGGTAGCAGGGACGTTAGTAGACGCCGTTGCA
AGGTCGACCGGCTCAACGGGATGGTCGGCAACCGCGGCGTCAGTCATGGAGGAGTCAAGTGCTTGATCACCAGGCGCTTCGCTCACACGAGGTGAGTCCC
AGGCACAGGGACGTCAGCAGACACTGTTGCAGGGTCGACAAGGTGGTCAGCAGGAACGTCTGCGGTTTCGCCGGGGTTGCGCGCTTGATCTCCGGCTACT
TCGTCACTGCGAGGTGAGCCAAAGGCAACGGGGACGGTCACCGACACAGCGGCGATGTTGACAGAGTCGGCCGGGTGATCGACAGGAACGGCTCCTGCCC
CGACCGTGTTGCATGCTTCGTCACCATTCACCTCGACATTGGGAGGTGAGTCAAAGTTCGCGGGGACGTCAACACGCACGGCAGTGAAGCCGACCGGGTC
GACAGGGTGGTCAGCTGGGACAGCTTTGTTTCCGACAGGGTGGGCTGCTTGGTCGCTGGACATCACGCCACTGCGATGTGATCCAAGGTCCACGGAGACA
GCAATGGGTGGAGAGCCACGTCGGCCGAGACGACGGGAAGGTCAGTCGCAGCGCTTCCGGGTTCGGCAGGAGCGTGTCCGGGGTCATCAGACAGTGTGTC
AACTTGGGGCGAGTTACGATCATTAAGACCTCCAGTGTCGCCGGTCGCGTCTAGCGTATGACCAGCACGTTTTTCATCATCAAGAACGGGGATGGTTGAT
CGCAGCAGGGCCGGCTGAAGGGGTGCTGAACCCGAAGCCAGGGGTTGACCAGCGGCGGGGCGGGTTGGAAGCGACATCTCTCCAAGCTTATCGGATAATT
AAAAATGCGAGAGTTGAACGGAGCATGTAAGTGAAAAAGTGCTTGCCGATTACTGGATCAGGGGACGACTGTGGTGAAGTGGTCGGGAGAAGTAATGACC
AATCGTATCTTTTCACATCATGGGTACATGCGGGATCGGTCACGCCGGCATTGGGACTGACCGCTAGAAACTTCCAACGGTACGGTGGAAAGTTGACAAG
TCATCAGTCGCGGTCATAGACGGTGACCAGCGGTCATGTTGGCAGTTGAGGTGGGTCACTTCAAGCACAGGGAATGGGTGTCGGAGGCGAACGACGTTAC
AGAAACTGAGATATAGAGAAGTATAAGCGTAGTTCTAGCTCCTAATAGGTTGATAACGAACAGTATTGATTTTCGTACAAAAGACACGCATCAGCATCCC
TCCGGGCTGGAATTCTAGTGGCCACCCTACGTTCAAGGTTTACTGCTCACGTGTTTGTTCACGTTTTGTCCCTAGATTGCTTGGCTAGGGACAAGGATAC
TCATTCAAGTTAGCCCGCTTGATCGGACGCGGCAAGCATATAAAGGCAAGGTCTTCAGACGGCTCAAGTGATCAGAAGAACAAGTTGATCAAGTGGTCAG
AAGAACAAGGGGATCAAGTATCCACATTTGGGCAAGGCGACCTCAAGGAAGGTCAGTGCGACTCTGGGAGAGCACCACAACTAACTGTTGGTCGTATGAA
GAATTCCCACGCGACCACACCCCACCTATCCCCAACTCGGTCAGGCCATACATCGCCCTCAAGCCACCTAGAAGAGTGCAACCCTCCCGCCTACGGATAC
ACAGGGTGAGAAAGAACAAGACAAGACACACGGTCCGGAGTCCCCCCTCCGTTAGTCGGTCGTCCGGGCGCAAGTAAAGAGTTGGGATCGCTTCGCAAAA
TGAGCGAATCCCACTCTACCACAGATGTA