Description :
From Genome Similarity Track
Location :
Scaffold_19:193705- 195629
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007667Protein of unknown function

Sequence
1924 bases(100 bases per row)
AAGCTGATTAATGATCGCCTTACATCATGTGATTCGCTTGTACTCACAGATTTCAGTTCGCATTCTTCTATTTCGGAAGCAGTTGCTGCCGGAGAGGGCA
TCTGGAGTCTTGAAAAAGCTGGAGAATCTACTGAGTTGCCCAATTATTTGGCGCAGACGGTGAACATCGAAGCAATGAACTGGTACGCTGAAAAGGGATC
ACAGCCGTCTTTGTCATTGGAACTTGTTCCTTTAGACGATGTCCGTTTCTGCGCAACGGATGTGAACGGAGCGATTCATGAGATTTGCTTACCAGCCGAA
AAAATTGTGGGCGACGCACGACTGCGGCGACGGATGACTCCTTTTTCAGAGGCCATCGTGAAAGAAGGTCCGCTCTTCATCTCTGCCGATCATCCAAAGA
GACAGCAGATTCGCAAGTCTATTCGAGGATTCAAGAGCGTGAGTCATGGGAACAATCGTAACGTGGAGGTTTCTCCATATTATGAAATCGAGTACATCAG
TTCAAGCACCAAAGAACCTGCCAAGGCGATAGTGTTCCAAGACGATCTCAAGTTTGACACAATGCGTGTTCGCGTTGTGCAAGTTTGCGAAATGAGGGGA
ATTGGCAACAACAATATTATTGCCCAAGTGATGCTTGTTTCCAAGGATTTCAAGTGCCAAAAGCCCAGCGACCAAGCCCTGGTGACTCCACTTGGTGTGG
CCCTGACTTTGAAAGGAGAGATCTGCGTTGATCTCCTAGGTGGAAAGTACCCCGAATCGTCCTCAATACAACTGTCACGGCAGGCGAAGACTGGTGCTTG
GACGCAAGCTGTCGAGAAACCGAAAGAACTATTTTTTGGATACCCTGCGGTAGATTTACAGCGTGTCTCTGGGGTGAGAATCGATTTGATGGAGAAAGGG
AGCAAAACAGCTTCTTTTGGCACCGCGTTCATTTCCATGAACCAAATCCACCAAACTTCTGCGTGGGCTGAAAGCGAGTATCGAAAACATTCTGAAAGCC
CTTCAGCGAGTGATAGTGCTACCACCAAGGATTTCAGCATCGAGCGCGAAGAGCATGGTTACAAGGTTGTCGTCGGCAAAATTACTCTTGAAATTGATCG
CACGCAACGCATTTCGAAGGGGCAAAAAGTGCAGGCAAAGAGGTTCAAGAAAGAGCAAGATGCGTGGCAAATTGATCCATACGAGCTGCTTGTCTCGACG
CTGAAGCTTCATGACAATAAACTGACTCGTGGATTACTGGCGGCTGGTCCCATCATATCTGGTGGCGGTCGGATTAAGCTCTCAGATCCCAAGGAACAAG
AGCTACAGCTTCAAAAAGTGGCCAACGTGATGCTGATATCGCATGCGATGGAGAAACTTTATGCCACAAAAACAACTTCGTCGTCACAGAGCCCACTTCG
GCTTGAAATGAGACGCGAAAATAACCTGCGATCACCACGAGCAATGGACCAGATAAAGCAAGCTTTTGCGCAAACCAAGTGGATCTTGGAGGATACAGCC
ACCGAGCTTGGCATCAAAACGATCGGTAGACGCTTGCCATGGTCCTCGGATCTTGTCCATGATGAGAAGAAGTCAAGTAGTGATGACCTCGTTGTGATGC
ATGCCAACATTACGACGTCAACGCTCCGTCTGCGCCGAACGATCTTGAAACTCTATAATATGTTTTGCCGTCGGCTGATTCCAACCCTGCAGAGATTGCA
TGAACTGGACGCAATGGGAGATAACATTAACGTATCCGACGGTGAGCAGGTGCTGAATTTTTTTGAGGAGGAAGTGGAAGATTTGGACGAAGAGGACCAG
ACCGTGTATCGGCGGGTGTACCAGCGATTGCGACTGATGAGGATGTATCAAGTGCTGGAAGATATCATGTGTACGACGCTCCGCATCAAAGTGATGGATC
AAGATCCAGGTATCGGTAACGACC