Description :
From Genome Similarity Track
Location :
Scaffold_10:1936752- 1937990
Transcript NameFunction/comments
Physo_320549conserved unknown protein

Sequence
1238 bases(100 bases per row)
GTGACTCGGCGCGTCGGCGAAGTAGGTTTGTAGGATAAACGCGCGTGACAGCAAAGGCTCGATCTCGTTCTCAACCCAGTCTTTCGTCGGCAGGCTCTGC
AGAAAGAGCACGAGGTCCTGGAACTCGAGCGTCTTGAGCGCCTCGCCAAACGTCATGAGAATGGCGGCGCACACGTACACGTGGAAGCTTTCGAAGCCCG
AGTCTTCACACAGGTACGTATCCCAGATGCGCACGATTCCGTCCAGTGGTAGCTCGCGCATTAACAAACAGTTCATCCAGCGGAACGCAAACTGCACGAA
CTGCACATTCTCACGCTCCACGATGTGCTCGAAGAGCTCCGCGTCACACCGGTGAACCAGTTCCTCCATGCGCTGCACCATGCGTTGCAAACCTGGCTGC
GCGAACGTGTAATGGTCCTGGATATCGTCCAGAAGCTTCGTCAAGCACCAGTAGCTGTCCGCTTCGACGATCTGCAGGTTTTCATCCGACACCTCCGACA
AGTCGCATGTCTGAGGCTCATCTGCAATCGACAAGCGCCACAAAAGACATCTCCTTAGCATTCCCATAGTTTTCAGCATAGATCAGGCTCGAATCGCTGC
TTACCGATGAAAGCCGAAAGAAAGACGACTAAGAACGGCGTCATGAGGTCGTTGATTCCTTGAACGTAGCCGCTGGCTGGGTGTCGGATTGCCCAAATAT
ACAGAACGCGCTCCATGCACTACATACACACGATAGCAACCAACGAGCGATATTGCAACTTTGTCAATACGATTCAGCGCCACCCCATCAAACGAATGCT
CTGGCCTGGCTCACCTGGTGAATGCGCTCATTTTGGAAGAGCTTAACGTCAGCGTTGGTGCGTGGAATATCGACGAGGATCTGCCGCAGCGTGGTCTGCT
CGCGCGTACCCCGGTCGGTGTCCGGGATATAATAATACTGCTGCAACAGTTCCACGTACTCCTGTCGTTTTCTCTCTAACATGGCGGCTCGACGGTCCTG
CTTCGGCGGCATGTAACCCTGTAAGCATACGAGGCAAAAACGTGAGAGTCAAGCACGTCATGTATGCAGCAAATACCACGGCAAAGATCGTACCAACAGT
AGCCGCCAGACTGTGGGCCGGTGCTTCGTAGGTACGCCACCCCAGCTGAGCTTGCGAAGCTGGTCCAGGTCGACGACCTCCTTCTCCAGCAACCGCTCAA
ACTGCGTGTACCGAAGGTTTCCCGACGCATTGCGCGAC