Description :
From Genome Similarity Track
Location :
Scaffold_1675:1936- 4025
Sequence
2089 bases(100 bases per row)
ATGGTTCCGAATCCCAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTACGGGTGTGTTCCCTTGCCTTT
GTAGCTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAAAGTTGAGAGCCTCTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAGCCTG
TCGGATTTGCACAAGTAAAGAAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCACTACCAACACTAGATTCGCATTTCCTAACT
TCCTCCTAGCTCGTACGGTCAATGTAGTTGCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGATACTGTGCAAATTGGGTTCTGTATTGATATTTAAGCCT
ATACCTGCCTGGATTTCTACCTTCTATGTCTTTCATCTGCTAAATCCCTTACCAGGCTCGGCTGCATGTCCCTTCTTCCCTTGACCCATCATCCGAGCTG
TGTTATCTTCAGATCCACCGGATCCATGACGTAATCATCATGGTCACCCTATTATGGGTACACTCATCCGGATCCAGGTCGCTTGGATCCACCTCACTGT
AATTGTACACTCGCCGTGGATCCGAGCTCTCCAATCATCCAACATCATCTTGCAACCGTCTGTGATCTCCATTGTCCCACGGAAGTTCCAGATCCACTGC
ATCCCTCATCCCTGTACCCTGGATCCAGGTCCTTCTATGCGGGATCCTTCCTCCTTGGACCCGAACTCGGGAGTATGGGATCCGGGGTACCTCGCGGTGG
ATCTTGACTCTTCATTAGCCGTGGCTACTAGATCCACTTTCAGAGGGCACCGACCATCCTTCCTTCATAGGATCCACATTCGATCCACTCTTGTATAGTA
TATCTCATATCCTTTTAAGTGAATCCAGGTAAGGGTGGATCCGAGGTAAGTCTTGGTGGATCTTGCCTTCTCGTACATCGCTCATATCAGATCCATCGTC
ATTCCATACGGGGTGCTGCTCGCCATGGCTAATCCACCACAGGCAACTTGCATCCGTGCCAGCCAACCCAAATCCTCTCTAATCACTTGAAATTGTCACT
GATTCGGGATAGTGACCCCGCGTCAGGCCCATTCTCTTATTTCTGAAAAAGCACTTCACCACAAACATGCTGATATATTTTAGAGATAATGGAAAAGTAA
TGTTATTTTCTATGATGATTTAGCTAGACACGCTGTAGCTTATGAACCTAGTAAACACATAGATAGCATAGCATAAATCTAATTCGAGGTCGTGTATCTA
CCAGGCTGACGTAGGAACTTGAATTAATGCGATAAACGAATGCCGTTGCTATCATTATTCGGCCCTAGCTTAAAAAGGAAAATTACTACTGAACCCTCGC
TAAAATGTCACAAAGGGTGAGAAGTTCTCGTCCAAAGTGAAGTTGTACCACAATCCAACGATTGCATTGTTTGTCGCAGCTGCTTGGACCTGGTGTGACG
AGTCTGGACCGAACATATCTTCTGTATGCTGTCGAATAGATTGGCTATTTCATCATCTAGTTGCACCTTAACCTCCATGTTCTCGTAAGTTGAGGCGCTA
TATATGATGTGTTTAGCTTCCGTCAGTTTTTCGGCATCAAATTTATGTTGGCCGCTACAAAAAAGACATCATGGTTGTATTGAACAAATCTCGAGAGAGT
TTAACAGTGAGGCGTAGTCAATGTGCGAGCGAAAAACGGCCAAATGAACCGGCTTAGGGTAGATAGACCATATCCCCGGTTAAAGGGGTAAAGAGAGGCG
GTTCCATCCACTCATGGGTGGCTGACAGTCGACGAGTTATCTCGCTCTTCCAAAAAAGAGCGTGAGATCGACAAAGTAAAAGAAGGAAACCAGAAATGGT
TGCGGACGTCGGGCCCAGACACATTGCCATGTTTGTGACATCAGAAGCGTCTCAGCCAGTGTCTGGTAGGAGCTGGATGAACCGTTACCGGTGCCGCCAT
CACCAAAATGCGGAGGGGCCGGCAGCCGAGCCCACAGAAAGACGAATGGGCTGCAGGGGCTAAAAGTCACTACATCTTATACGAAGAAG